ID: 1032268394

View in Genome Browser
Species Human (GRCh38)
Location 7:130383806-130383828
Sequence CTCCTGTCCTTGGGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032268386_1032268394 5 Left 1032268386 7:130383778-130383800 CCTTCACGCACAGCACGGTACCG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG 0: 1
1: 0
2: 1
3: 37
4: 390
1032268383_1032268394 19 Left 1032268383 7:130383764-130383786 CCCTGATGGCTTTGCCTTCACGC 0: 1
1: 1
2: 1
3: 11
4: 120
Right 1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG 0: 1
1: 0
2: 1
3: 37
4: 390
1032268382_1032268394 23 Left 1032268382 7:130383760-130383782 CCAACCCTGATGGCTTTGCCTTC 0: 1
1: 0
2: 1
3: 30
4: 261
Right 1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG 0: 1
1: 0
2: 1
3: 37
4: 390
1032268384_1032268394 18 Left 1032268384 7:130383765-130383787 CCTGATGGCTTTGCCTTCACGCA 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG 0: 1
1: 0
2: 1
3: 37
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032268394 Original CRISPR CTCCTGTCCTTGGGGGAAGC AGG Intronic
900125233 1:1066097-1066119 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900469613 1:2847283-2847305 CTGCTGGCCTTGGGGGAGGCGGG - Intergenic
900525250 1:3125360-3125382 CTCCTGTCCTTTCTGGAAGTGGG + Intronic
900654540 1:3748758-3748780 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
900878377 1:5362691-5362713 CTCCTGACTATGGAGGAAGCAGG - Intergenic
901061666 1:6474583-6474605 CTCCTGTCCTGGGGGCAGGGAGG - Exonic
901190129 1:7404751-7404773 CTCCTTTCCTTTGGGGCAGCTGG + Intronic
901325792 1:8364406-8364428 CTCCTGGCCTTGGGGGAGCAGGG - Intronic
901929058 1:12585442-12585464 CTCAGGTCCTTGGTGGATGCTGG + Intronic
902036939 1:13464749-13464771 CACCTGTCCCTGGAGGAAGGAGG - Intergenic
902160972 1:14530151-14530173 CTCCTGGCACTGGGGGAAGGTGG - Intergenic
902530969 1:17090431-17090453 CCCCTGGCCTTGGGGAGAGCTGG + Intronic
902885334 1:19400699-19400721 CTCCTGTTGTTGTTGGAAGCCGG - Intronic
903466581 1:23556183-23556205 CTTCTGTCCTGGGAGGCAGCAGG + Intergenic
904082221 1:27879520-27879542 CACCTGTCCCTGGGGGATTCTGG + Intronic
905384499 1:37592079-37592101 CCTCTGTCCTTGGGGGCAGGTGG - Intronic
910665750 1:89724553-89724575 CTCCTTTTCTTTGGGCAAGCAGG + Intronic
912425196 1:109582093-109582115 CTCCTACCCTTGAGTGAAGCAGG - Intronic
914860010 1:151378028-151378050 CTCCTGTCCTTCTGGGACACTGG - Intergenic
914981228 1:152416058-152416080 CTCCAGTCCTGGGGTGAAGGTGG + Intergenic
915102204 1:153508505-153508527 CTCTTGTAAGTGGGGGAAGCAGG - Intergenic
915233194 1:154461357-154461379 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
915937036 1:160095671-160095693 CTCCTTTGCTTGAGGGGAGCTGG + Intronic
919866029 1:201783609-201783631 CTCCAGGCCCTGGGAGAAGCTGG - Exonic
919911637 1:202114647-202114669 CCCCTTTCCTTGGGGGAAAGGGG - Intergenic
920389858 1:205592647-205592669 CTCCTGACTTTGGCGGGAGCAGG + Intronic
920400016 1:205670570-205670592 CTCCAGGCCCTGGGGGAGGCAGG - Intronic
920540311 1:206773159-206773181 CAACTGTGCTTGGGGGAAGTGGG + Intergenic
921069787 1:211649445-211649467 TGTGTGTCCTTGGGGGAAGCTGG + Intergenic
921171893 1:212558225-212558247 CTCCTGTCCTTGGGTGGGGGTGG - Intergenic
921899859 1:220438788-220438810 CTCTCTTGCTTGGGGGAAGCCGG - Intergenic
922616138 1:226962221-226962243 CTCCTTTCCTTGGTGGCAGCTGG + Intronic
924459386 1:244244859-244244881 CACCTGTTCTTGGGAGAAGAGGG + Intergenic
1063072139 10:2677490-2677512 CTACTCTCCTTGTGGGAACCAGG - Intergenic
1064415471 10:15145758-15145780 CTCCTGTCCCTGGGGGTGACAGG + Intronic
1064559001 10:16577257-16577279 CCCCTGGCCTGGAGGGAAGCTGG + Intergenic
1066302333 10:34108127-34108149 CACCTGTCCTTTGGGAAAGATGG - Intergenic
1066997548 10:42577964-42577986 GTCCTGGCCTAGGTGGAAGCAGG + Intronic
1067739513 10:48883758-48883780 ATCCTGGCCCTGGGGGATGCTGG + Intronic
1068771668 10:60828414-60828436 CTGCTGCCCATGGGAGAAGCTGG - Intergenic
1069078821 10:64066279-64066301 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1069600340 10:69701444-69701466 CTCCTCTCCTTGAGGGGGGCTGG - Intergenic
1070170774 10:73931243-73931265 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1070772621 10:79091120-79091142 GTCCTGTGCTTTGGGGAAGCTGG + Intronic
1070796033 10:79216861-79216883 CTCCTGACCTTGCAGTAAGCAGG + Intronic
1071186276 10:83049806-83049828 CTCCTTTCCTTGCGGGATTCTGG + Intergenic
1071425608 10:85546123-85546145 GTCCTCTGCTAGGGGGAAGCTGG + Intergenic
1071872062 10:89806665-89806687 GTGCTGTCCGTGGGGCAAGCCGG + Intergenic
1071970088 10:90896264-90896286 CTCGTGTCCTTGGGTGACTCTGG + Intronic
1072499127 10:95994557-95994579 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1072818988 10:98537725-98537747 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1073072651 10:100804477-100804499 CTCCTACCTTTTGGGGAAGCCGG - Intronic
1073342896 10:102759132-102759154 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1073373887 10:103016136-103016158 ATTCTAGCCTTGGGGGAAGCGGG - Intronic
1076093896 10:127714547-127714569 CTCCTGTGGCTGGAGGAAGCAGG + Intergenic
1076114958 10:127888852-127888874 TGCCTGGCCTTGGTGGAAGCTGG + Intronic
1076897756 10:133322185-133322207 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1076906987 10:133367578-133367600 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1077001481 11:325379-325401 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1077052533 11:574042-574064 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1077066078 11:641420-641442 CCCCTGACCCTGGGGGAAGAGGG + Intergenic
1077197911 11:1290559-1290581 CTCCTGGCCTCCTGGGAAGCAGG - Intronic
1078409229 11:11098143-11098165 CACCTGTCCTGGGAGGAACCTGG - Intergenic
1078552056 11:12287920-12287942 CTCCTCTCCTAGGGTGAGGCTGG - Intronic
1079003829 11:16778934-16778956 GTCATCTCCTTGGAGGAAGCTGG + Intronic
1079427312 11:20356059-20356081 CTCCTGTCATTGTGTGAAGAAGG - Intergenic
1080070882 11:28085266-28085288 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1083277738 11:61606681-61606703 CACCTGCCCCTGGGAGAAGCAGG - Intergenic
1083419374 11:62544686-62544708 CTCCAGTCCTTAGGGACAGCGGG - Intronic
1083815477 11:65130281-65130303 CTCCTGAGCTGGGGGGAGGCGGG + Exonic
1083875570 11:65522380-65522402 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1083889849 11:65590277-65590299 TTCCTGACCTTGGGAGGAGCTGG + Intronic
1083932834 11:65855273-65855295 CACCTGCCCTTGGGGGTTGCAGG - Exonic
1084592315 11:70097906-70097928 CTCCTATCCGTGCTGGAAGCTGG + Intronic
1085266057 11:75238778-75238800 CTCCTTTCCTGGGGGGCAGCAGG + Intergenic
1089082399 11:115787914-115787936 CTGCTGACCTTGGGGGAAGAAGG + Intergenic
1089656247 11:119948874-119948896 CACCTGGCCTTGGGGGAACTAGG - Intergenic
1090196652 11:124822210-124822232 CTCCTGTTCTGGGTGGAACCTGG + Intergenic
1092441364 12:8508178-8508200 CTCCCCTGCTTGGGGGCAGCAGG + Intergenic
1093289603 12:17303794-17303816 CACCTGTCCTTATGGGTAGCAGG - Intergenic
1096572066 12:52529202-52529224 CCCCAGTCCTTCGGTGAAGCAGG + Intergenic
1096780869 12:53991443-53991465 GCCCTGGCCCTGGGGGAAGCTGG - Intronic
1096828237 12:54295385-54295407 CTCCTTCCCTCAGGGGAAGCTGG - Exonic
1098625455 12:72660401-72660423 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1099973852 12:89525918-89525940 CTCCTGTGGGTGGGGGAACCCGG + Exonic
1100953113 12:99875019-99875041 CTCCTGGCCTTGGGGTAAAGAGG + Intronic
1101615553 12:106333204-106333226 ATGCTGTCCTTGGGGGCAGCTGG + Intronic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1102471949 12:113164178-113164200 CTGCTGTCCCTGCTGGAAGCGGG + Exonic
1104795855 12:131516966-131516988 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1104882015 12:132078456-132078478 CTCCAGTTTTCGGGGGAAGCTGG + Exonic
1104885135 12:132102929-132102951 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1104913771 12:132253320-132253342 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1105207981 13:18239000-18239022 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1105504352 13:20997582-20997604 CTGCTGTCCCTCGGGGAAGCTGG + Intronic
1105855610 13:24369241-24369263 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1106574148 13:30958548-30958570 CTCCTGTCCTCGGGTGAACAGGG - Intronic
1108003736 13:45927366-45927388 CTGCAGACCTTGGGGGAAGTTGG + Intergenic
1111108503 13:83675984-83676006 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1112325202 13:98439224-98439246 GGCCTGTCCTCGGGGGCAGCAGG + Intronic
1115787655 14:36844370-36844392 CCCCTGCCCTTGCTGGAAGCTGG + Intronic
1117105787 14:52395783-52395805 CTCCCATCCTTGGGGGTAGGTGG - Intergenic
1118748813 14:68792400-68792422 CTCCACTCTTTGGGGGGAGCTGG - Intronic
1118907590 14:70033796-70033818 CTACTGTCCTTGGTGAATGCAGG - Intergenic
1120078616 14:80188856-80188878 CTCCTCTCCCTGCAGGAAGCTGG - Intergenic
1120294941 14:82628128-82628150 CTCCTGTCCTTGGACCAAGGTGG + Intergenic
1121583394 14:95046885-95046907 CTCCTGTCGGTGGGGGACACAGG - Intergenic
1121600377 14:95198984-95199006 TTCCTCTCCCTGGGGGAAGAGGG + Intronic
1122205244 14:100145077-100145099 CTCCTGGCCTGGGGGGCGGCAGG - Exonic
1122354496 14:101114819-101114841 CTCCTGGGCATGGGGGAACCAGG - Intergenic
1124345352 15:28918430-28918452 TCCCTGTCCTTGGAGGAAGCAGG + Intronic
1124631956 15:31343065-31343087 CTCCTGTGCTTGGGGAGAGGAGG + Intronic
1125547820 15:40520124-40520146 GTCCTTTCCTTGGAGGAAACTGG + Intergenic
1125599882 15:40909693-40909715 CTCCTTTCCTTCAGGGAACCAGG - Intergenic
1126416695 15:48425200-48425222 CTCCTGTGCTGGAGGGAAGGAGG - Intronic
1126765722 15:52009095-52009117 ATCCTGTCCTTTGAGGAAGAAGG - Intronic
1127417059 15:58768586-58768608 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1127900688 15:63338811-63338833 CTCCTCACCTTGGGAGAAGGAGG + Exonic
1129035696 15:72647247-72647269 CTCCTCTGCTTGGGGGAGGCAGG + Intergenic
1129214188 15:74089969-74089991 CTCCTCTGCTTGGGGGAGGCAGG - Intergenic
1129391235 15:75221962-75221984 CTCCTCTGCTTGGGGGAGGTAGG + Intergenic
1129399821 15:75275400-75275422 CTCCTCTGCTTGGGGGAGGCAGG + Intronic
1129473073 15:75765904-75765926 CTCCTCTGCTTGGGGGAGGCAGG - Intergenic
1129731323 15:77934312-77934334 CTTCTGTGCTTGGGGGAGGCAGG - Intergenic
1131178519 15:90224883-90224905 CTACTGTCCACTGGGGAAGCAGG + Intronic
1131821105 15:96274525-96274547 ATGCTGTCTTTGGGGAAAGCCGG + Intergenic
1132590948 16:726239-726261 CTCCTGGCCTTTGGGGGAACGGG + Intronic
1132797537 16:1732674-1732696 CACCTGTTCTCGGGGCAAGCTGG - Intronic
1132874612 16:2130779-2130801 CTCCTGTCATTCAGGGATGCAGG + Intronic
1133810083 16:9154927-9154949 TGCCTGTCCTGCGGGGAAGCGGG - Intergenic
1133879030 16:9763497-9763519 CTCCAGACCTTGGGGGAAAAGGG + Exonic
1134276344 16:12779900-12779922 CTCCTGTCCCTCAGGGAGGCAGG - Intronic
1134553555 16:15149612-15149634 CTCCTGTCATTCAGGGATGCAGG + Intergenic
1135135563 16:19883974-19883996 CCCCTCTCCTTGGGGGACACAGG - Intronic
1136710391 16:32232180-32232202 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1136757521 16:32697231-32697253 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1136810585 16:33173144-33173166 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1136817061 16:33283224-33283246 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1137602209 16:49763999-49764021 CTCCTGCCCGTGGGGCCAGCAGG - Intronic
1137918146 16:52455475-52455497 ATCATCTCCTTGGGGGAGGCAGG + Intronic
1139956711 16:70696785-70696807 CTCCTGCCCCTGGGAGAAGGTGG - Intronic
1140618511 16:76697098-76697120 ATCCTATTCTAGGGGGAAGCTGG + Intergenic
1140761314 16:78111573-78111595 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1141756836 16:85996986-85997008 CTGCAGGCCCTGGGGGAAGCGGG - Intergenic
1142401791 16:89862688-89862710 CTCCTGGCATTGGGGGGAGCGGG - Intronic
1203059669 16_KI270728v1_random:957580-957602 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1143420637 17:6789006-6789028 AGCCTGCCCTTGGGTGAAGCAGG + Intronic
1143459433 17:7091883-7091905 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1143499995 17:7333129-7333151 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1144735415 17:17552909-17552931 CTCCTGGCCTGGGGGAAAGGGGG - Intronic
1147168269 17:38604713-38604735 GTCCTGTCGGTGGGGGCAGCAGG - Intronic
1147650944 17:42061759-42061781 CTGCAGTCCCTGGGGGCAGCAGG - Intronic
1148211153 17:45809469-45809491 CACCTGTCCTTGGAGCCAGCAGG + Intronic
1148474199 17:47916380-47916402 CTCCTATCCTGGAGGGCAGCTGG + Exonic
1148961376 17:51396141-51396163 CTCCTGCCCATGGGGGGAGACGG - Intergenic
1149453251 17:56766549-56766571 CTAATGTCCTTGGGGGCAACAGG + Intergenic
1149577879 17:57726942-57726964 CTCTTGGCCTTGGAGGAGGCGGG + Intergenic
1150137078 17:62701970-62701992 ATGCTGTCTTTGGGGGAAGCTGG - Intronic
1150576398 17:66434456-66434478 ATCCTGTCCTTGGGTGAACAGGG + Intronic
1151108806 17:71651326-71651348 CTCCTGGCCTCAAGGGAAGCTGG - Intergenic
1151338684 17:73455950-73455972 CACCTGTGGCTGGGGGAAGCTGG + Exonic
1151851205 17:76691107-76691129 CTCCAGTCTCTGGAGGAAGCTGG - Intronic
1151997570 17:77619582-77619604 CTCCTCTTCTTGGGTGAACCTGG + Intergenic
1152132383 17:78485107-78485129 CTTCTGTCCTCCGGGGAAGCAGG - Intronic
1152542295 17:80982378-80982400 CTCCAGCCCTAGGAGGAAGCTGG + Intergenic
1152562142 17:81083888-81083910 CCCCTCTCTTTGGTGGAAGCAGG + Intronic
1153814897 18:8783680-8783702 CCCCTGCCCACGGGGGAAGCAGG + Exonic
1158694401 18:59690783-59690805 CACCTGTTCTTGTGGGAAGGCGG + Intronic
1158909267 18:62043236-62043258 ACCCTGTCCTTGGGAGAACCTGG - Intergenic
1160556552 18:79729373-79729395 CCCATGTCCTTGGGGTGAGCCGG - Intronic
1160572237 18:79826079-79826101 GCCCTGACCTTGGAGGAAGCGGG + Intergenic
1161203163 19:3027472-3027494 CTTCTGTCCTAGGAGGGAGCTGG - Intronic
1161587916 19:5115381-5115403 CTCCTGGCCTTGGGGGTTGGGGG - Intronic
1161870927 19:6869348-6869370 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1162328767 19:10014076-10014098 CTCCTGACCTTGGGGGTTGAAGG + Intronic
1163232585 19:16014594-16014616 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1164918760 19:32072886-32072908 CTGCTGTGCTGGTGGGAAGCAGG - Intergenic
1165852804 19:38860079-38860101 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1166090874 19:40508128-40508150 CTCCTGGCCCTGGGGTAGGCAGG - Intronic
1166231518 19:41427762-41427784 CTCCTGGCCATGGGTGCAGCCGG - Intronic
1166514623 19:43437175-43437197 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1166733852 19:45073134-45073156 TTCCTGTCCTGAGGGAAAGCCGG - Intronic
1167377795 19:49120674-49120696 CTCCTTTCCTTTGGGGGACCCGG + Intronic
1167895517 19:52577724-52577746 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1167927761 19:52835292-52835314 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1167939102 19:52932013-52932035 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1168058605 19:53877868-53877890 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1168084719 19:54037145-54037167 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1168110349 19:54188746-54188768 CTCCTGTCCTTGGAGAACCCAGG + Intronic
1168726372 19:58584594-58584616 CTCCTTTCCTTGGGGGAGTGAGG + Intergenic
925782537 2:7395131-7395153 CTCCTGTCCTTGGGTGTGGAGGG - Intergenic
927053438 2:19350667-19350689 CTCTTCTCCTTGGGGCAAGGCGG - Intergenic
927255594 2:21037981-21038003 CTTCTGTCTCTGGGGGAACCAGG + Exonic
927852131 2:26506082-26506104 CCCCTGTCCTTGGGGCCAGCAGG - Intronic
928419895 2:31130333-31130355 CTCCTGACCTTGGGGCCTGCAGG + Intronic
929218020 2:39436793-39436815 CGCCTGTCCTCGGGAGACGCTGG - Intronic
929249427 2:39736609-39736631 CTCCTGTCTTTGGGGGAATTTGG + Exonic
929665454 2:43830528-43830550 CTTCTGTCCTTGGAAGAACCTGG - Intronic
929906616 2:46051529-46051551 CTGCTCTCCTTTGGGGAACCTGG + Intronic
930100821 2:47601491-47601513 CTCTAGGCCTTGGGGGCAGCAGG - Intergenic
930762064 2:55049173-55049195 CTCCTGTGCTCGTGGGGAGCTGG - Intronic
931085228 2:58822851-58822873 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
931116651 2:59173187-59173209 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
931627788 2:64272402-64272424 CTGCTGAACTGGGGGGAAGCAGG + Intergenic
932294027 2:70609430-70609452 GTCCTGTCCTTGGGACAAGAAGG + Intronic
932736595 2:74258974-74258996 CTCCTGTCCTTGAGGTATGCAGG + Intronic
934136358 2:88999832-88999854 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
935592345 2:104855004-104855026 CTCCTGTCCTCGGGCGAGCCCGG - Intergenic
936050332 2:109217825-109217847 CTCCCCTGCCTGGGGGAAGCTGG - Intronic
936585703 2:113756275-113756297 CTCCTGCCCTCGGTGGCAGCAGG - Intronic
936978631 2:118243340-118243362 CACCTGTGCTTGGGGAAGGCAGG + Intergenic
938074064 2:128322635-128322657 CTTCAGTCCTTAGGGGAAGAGGG + Intergenic
939777559 2:146405675-146405697 CTCCTGTCATTTGGGGTAGATGG - Intergenic
940266141 2:151841028-151841050 CACGTGTCCTTTAGGGAAGCTGG - Intronic
941364775 2:164596812-164596834 GTCTTATCCTTGGGGAAAGCTGG + Intronic
943670957 2:190659717-190659739 CTGCTCTCCTTTGGGGACGCGGG - Exonic
944081013 2:195788304-195788326 TTCCTGCCCTTGGGGGAAGATGG - Intronic
945338427 2:208620031-208620053 CTCTAGACCTTGGGGGAAACAGG + Intronic
946048583 2:216841959-216841981 CTCGTGACCTTGGGGGCTGCTGG + Intergenic
946156193 2:217808241-217808263 CTCCTGTCCCTGGGGAATGGGGG - Intronic
946543484 2:220711406-220711428 CACATGTCCTGGGGGGAACCTGG + Intergenic
947635062 2:231676093-231676115 GTGCTGTTTTTGGGGGAAGCTGG - Intergenic
947974343 2:234352141-234352163 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1168882160 20:1216388-1216410 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1168904256 20:1391427-1391449 CTCATGTCCGTGAAGGAAGCTGG - Intronic
1169058260 20:2641537-2641559 CACCTGTCCTTTAGGGAAGCTGG + Exonic
1169171227 20:3467551-3467573 TTCTTGTCCTTGGAGGAACCAGG + Intergenic
1169322153 20:4641861-4641883 CTCTTCTCCTAGGGAGAAGCTGG - Intergenic
1171070453 20:22063003-22063025 CTCCTGTCCTGGGATGAGGCAGG - Intergenic
1172274086 20:33670413-33670435 CTCTGGTCCCTGTGGGAAGCGGG + Intronic
1173348000 20:42218607-42218629 TTTCTGTGCTTGGGAGAAGCTGG - Intronic
1173382177 20:42555650-42555672 CTCCTGTCTCTGGGGCAAGGAGG - Intronic
1173454363 20:43190838-43190860 CTGCTGTCCTGGGAGGCAGCTGG + Intergenic
1174199947 20:48800054-48800076 CTCCTGTCCATGTGGGACTCTGG + Intronic
1175998683 20:62822371-62822393 CACCTGTCCTTGGGGCAGGATGG - Intronic
1176524216 21:7853135-7853157 CTCCTATCTTTGTGGGAACCTGG + Intergenic
1177173280 21:17677112-17677134 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1177927983 21:27242737-27242759 CTCCTGTCCTTGGACAAATCTGG + Intergenic
1178658236 21:34483148-34483170 CTCCTATCTTTGTGGGAACCTGG + Intergenic
1179275991 21:39892043-39892065 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1179319324 21:40274547-40274569 CCCCTTTCCTTGGGGAAAGATGG + Intronic
1179324137 21:40323023-40323045 AGCCTGTCCTTGGGTGAAGTGGG - Intronic
1179708366 21:43195306-43195328 CTCCTGTCCTGGGGTGAGTCAGG + Intergenic
1179730681 21:43365674-43365696 GACCTGTCCTTGGGGTGAGCAGG + Intergenic
1179914136 21:44465288-44465310 CTCCTGTCCTGCAGGGAAGCAGG - Intergenic
1179970228 21:44832747-44832769 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1180083712 21:45498099-45498121 TTCTTGTCCTTTGGGGGAGCAGG - Intronic
1180758546 22:18180885-18180907 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1180768833 22:18364677-18364699 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1180777479 22:18497718-18497740 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1180810199 22:18755028-18755050 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1180826708 22:18867901-18867923 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1180998808 22:19978433-19978455 CTCTTGACCTTGGGGTAAGGTGG - Intronic
1181196343 22:21189280-21189302 TTCCTGTCTTTTGGGGAAGATGG + Intergenic
1181213184 22:21303844-21303866 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1181523834 22:23466831-23466853 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1181963254 22:26638295-26638317 CTCAGGTCCTTGGGCAAAGCGGG + Intergenic
1182566398 22:31203229-31203251 GTCCTGACTTTGGGGGAAGGAGG - Intronic
1183410737 22:37653804-37653826 CTGGTGACCTTGGGGGAGGCTGG - Exonic
1183424960 22:37734512-37734534 CTGATGTCCTGGGGGGCAGCGGG - Exonic
1183600378 22:38836601-38836623 CTACTGTCTTTGGGGGCACCAGG + Intronic
1183829540 22:40410470-40410492 CTCCTGTCCTAGGGCCACGCTGG + Exonic
1184020712 22:41819527-41819549 ATCCTGCCCCTTGGGGAAGCAGG + Intronic
1185126930 22:49016618-49016640 CTCCAGGCCTTGGTGGAAGCAGG - Intergenic
1185172030 22:49299748-49299770 CCACTGTCCCTGGAGGAAGCTGG - Intergenic
1185222591 22:49636462-49636484 CTCCGGACCCTGGGGGAGGCTGG - Intronic
1203230455 22_KI270731v1_random:105561-105583 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
1203276851 22_KI270734v1_random:93811-93833 TTCCTGTCTTTTGGGGAAGATGG - Intergenic
949159915 3:869044-869066 ATATTGTCATTGGGGGAAGCTGG - Intergenic
949332047 3:2933423-2933445 CTTCTGTCATTGTGGGAACCTGG + Intronic
950714431 3:14837608-14837630 CCCCTCTCCGTGGGAGAAGCAGG - Intronic
952912470 3:38202921-38202943 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
953921617 3:46955791-46955813 CTGCTGTCCTTGGGGTGAGAAGG - Intronic
954106234 3:48411181-48411203 CTGCTGTCCCTGGGGAAGGCAGG - Intronic
954182154 3:48890034-48890056 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
954263243 3:49455101-49455123 CTCCGGTCCTTGGGGACTGCTGG + Intergenic
954676778 3:52320304-52320326 CACCTGTCCTGGGAGGCAGCTGG + Intronic
954970913 3:54651192-54651214 CTCCTGTACTTGGGGGCAGGAGG - Intronic
959738157 3:109685065-109685087 CTCCTTTCAGTGGGAGAAGCAGG - Intergenic
960592295 3:119378043-119378065 TTCCTGCCCTTGGAGGACGCTGG - Intronic
960672712 3:120168067-120168089 CTCCTTCCCTGGGGAGAAGCTGG + Exonic
960824369 3:121767547-121767569 CTCCTGGGCTTGGAGGAAACAGG + Intergenic
961454354 3:127016834-127016856 TTCCTGTCTTTGGGGAAGGCAGG + Intronic
961460144 3:127045001-127045023 CTTCTGTCCTACTGGGAAGCAGG - Intergenic
962285671 3:134084096-134084118 CTCCTGGCCTCCTGGGAAGCTGG + Intronic
962309209 3:134313562-134313584 CTCCTCTCCTTGGAGAACGCCGG + Intergenic
962316237 3:134361246-134361268 CTCCTGTCCTCGGCAGCAGCAGG - Intronic
962322403 3:134402731-134402753 CTCCTGCCCTTGTGGGCAACAGG + Intergenic
962344129 3:134607461-134607483 CTCCTGTCCTGGGCGGATGGAGG + Intronic
962350383 3:134651734-134651756 CTCCTGCCCTGTGGGGAAGGAGG + Intronic
963326976 3:143874046-143874068 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
966769083 3:183488247-183488269 CTCCTGTCCTAGAGGGAAGGTGG - Exonic
966962622 3:184955110-184955132 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
968457074 4:705444-705466 CTGCTGTCCTTTGTGGGAGCCGG - Intergenic
968910307 4:3474009-3474031 ATCCTGTTTTGGGGGGAAGCTGG - Intronic
969482054 4:7451900-7451922 CTCCTGTCCTGGGAGGAGGAAGG - Intronic
969610645 4:8225936-8225958 ACCCTGGCCTTGGGGGCAGCTGG - Intronic
970536452 4:17035024-17035046 ATGCTGTTATTGGGGGAAGCTGG - Intergenic
971819140 4:31529892-31529914 CTCCTCAGCTTGGGGGTAGCAGG + Intergenic
973266798 4:48219331-48219353 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
974094682 4:57350738-57350760 CTCTTCAACTTGGGGGAAGCAGG + Intergenic
976254413 4:83085125-83085147 CTCCTTTCCTTGGTGGAGTCAGG + Intergenic
979530626 4:121765554-121765576 CCCCTGTCCTTTCGGAAAGCAGG - Intergenic
980688422 4:136260456-136260478 CTCCTGTCCTGGCTGAAAGCAGG - Intergenic
981139696 4:141254093-141254115 CTCCTGTTCCTAGGGGAAGGGGG - Intergenic
982095327 4:151916984-151917006 CTCCTGTCCGTGGCTGAATCAGG - Intergenic
982395126 4:154907848-154907870 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
982716532 4:158814683-158814705 CTCCTGTCTTTGGGGGAGGGAGG + Intronic
983802385 4:171949143-171949165 CTGATGGCCTTGGGGAAAGCAGG + Intronic
985171398 4:187153884-187153906 CTCCTCTCCTTAGGACAAGCTGG - Intergenic
985825666 5:2189041-2189063 TTGCTTTCCTTGGGGGAAGCTGG + Intergenic
985986776 5:3522662-3522684 TTCCTGGCCTTGGTGGCAGCAGG - Intergenic
991201888 5:64004288-64004310 CTACTGTCCTTGGAGGACACAGG + Intergenic
991700642 5:69313308-69313330 CACCTGTCCTCGGGGGTTGCAGG - Intronic
992454362 5:76902688-76902710 TTGCTGTCCTTGGGGGAGGCAGG + Intronic
992759686 5:79940291-79940313 CTCCTGCCCTTGTGGCAGGCAGG + Intergenic
995550240 5:113274277-113274299 CCCCTTTCCTAGGGGGAAGTTGG - Intronic
996659779 5:125988414-125988436 GTCCTGTCCTTCAGGGAAGCAGG + Intergenic
997746943 5:136307617-136307639 CTAATGTCCTTGGAGGAAGGGGG - Intronic
998103767 5:139455506-139455528 GTCCTTCCCTAGGGGGAAGCGGG - Intronic
998327003 5:141289726-141289748 CTGCTTTCCTTCGGGGAATCTGG + Intergenic
998758158 5:145403440-145403462 CTACTGTGCATGGGGGAAGCAGG - Intergenic
1000050460 5:157558658-157558680 CTCTTGACCTGGGAGGAAGCTGG + Intronic
1001559076 5:172657704-172657726 CTCCTTTCCTTGGAGGAGTCAGG + Intronic
1001993527 5:176135585-176135607 CTGCTGGCCTTGGGGGCTGCAGG + Intergenic
1002099037 5:176848270-176848292 CTCTTGTGCTTTGGGGTAGCAGG - Intronic
1002277856 5:178114811-178114833 TTCCTGACCTGGGGGGCAGCAGG + Intronic
1002925719 6:1604817-1604839 CTCAGGTCCTCGGGGGAGGCCGG + Intergenic
1003017448 6:2479351-2479373 AGCCTGTCCTTGGGCCAAGCAGG + Intergenic
1003528354 6:6917101-6917123 CTGCTGCCCTGGTGGGAAGCTGG + Intergenic
1003855402 6:10268624-10268646 CTGCTGTCCTCCGTGGAAGCCGG - Intergenic
1004878046 6:19976074-19976096 CTCCAGGCCTTGGGGGAAAATGG - Intergenic
1006285195 6:33087723-33087745 CTCCTGAAATTGGAGGAAGCCGG - Intergenic
1007166181 6:39830624-39830646 ATCCTGGCCTTGGGGGAGGTGGG - Intronic
1007551646 6:42734341-42734363 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1007947594 6:45840081-45840103 CTCATGTCGGTGTGGGAAGCTGG - Intergenic
1008208702 6:48694375-48694397 CTCCAGTCCCATGGGGAAGCTGG - Intergenic
1008771905 6:54989439-54989461 CTCGTGTCATGGGAGGAAGCTGG - Intergenic
1013067232 6:106695531-106695553 CTCTTGTATTTAGGGGAAGCTGG + Intergenic
1014688965 6:124537370-124537392 GTCCTCTCCTTGGTGAAAGCTGG + Intronic
1016469336 6:144359215-144359237 GTCCTGTGCTTTGGGGATGCTGG + Intronic
1017522835 6:155216865-155216887 CACCGGTGATTGGGGGAAGCTGG - Intronic
1017820801 6:158047954-158047976 CTCCTGTCTTTGTGGGAACAGGG + Intronic
1017995450 6:159528065-159528087 TCCCTGCCCTTGGGGGAAGTCGG - Intergenic
1018998088 6:168725356-168725378 CTGGTGTCCTCGGGTGAAGCTGG + Intergenic
1019139982 6:169936962-169936984 CTGGTGTCCTTAGGGGAAGAGGG - Intergenic
1019257620 7:62048-62070 CTCCTGTCCCTCAGGGAAGGGGG - Intergenic
1019423222 7:961232-961254 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1019432702 7:1006874-1006896 CTCCTGGCTTTGTGTGAAGCTGG - Intronic
1019565676 7:1677879-1677901 CCCCTGTCCTTGGGGTAGGCAGG + Intergenic
1020114909 7:5470835-5470857 CTCCAGGCCTTGGGTGAAGGAGG - Intronic
1023055051 7:36284428-36284450 CTTCTGTCTTTGGGGGGAGGTGG - Intronic
1023788745 7:43735156-43735178 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG + Intergenic
1024456533 7:49614850-49614872 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1026870104 7:73845773-73845795 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1028370514 7:90087006-90087028 CTCCTGGCCTTGTGGTCAGCTGG - Intergenic
1029284160 7:99454621-99454643 CTCCTGGCTCTGTGGGAAGCGGG + Intronic
1029859991 7:103560642-103560664 CTCCTGGTTTTGGGGGCAGCGGG - Intronic
1031774328 7:125888147-125888169 CTCCTGACCTTGAGGGAATGAGG - Intergenic
1031789829 7:126088015-126088037 CACATGTCATTGGGGGAACCAGG - Intergenic
1032268394 7:130383806-130383828 CTCCTGTCCTTGGGGGAAGCAGG + Intronic
1032954072 7:136950364-136950386 CTCCTGTCCCTGCGGGATGGGGG + Intronic
1033013096 7:137643430-137643452 TTCCTGTCCAGGGTGGAAGCTGG + Intronic
1034359087 7:150478205-150478227 CTCCTGGGCATGGCGGAAGCAGG + Exonic
1034421743 7:150994442-150994464 CTCGGGCCCTTGGGGTAAGCAGG + Intronic
1034746895 7:153530687-153530709 CTCCTGTTGTGGGGGGGAGCGGG - Intergenic
1035261347 7:157663496-157663518 CCCCCGTCCTTGGAGGGAGCTGG - Intronic
1035410170 7:158633599-158633621 CTCTTCTCCTTGGGGGACTCAGG - Intronic
1035569545 8:663002-663024 GTCCTGTCCTCGGGTGACGCTGG + Intronic
1037025294 8:14028180-14028202 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1037289086 8:17332157-17332179 CTCCTGTCCTTGGTGGGTGGAGG - Intronic
1037802409 8:22042879-22042901 CTCCTGAGCTTGGGGGCAGGGGG + Exonic
1038760659 8:30382446-30382468 CTCATGTAATTGAGGGAAGCTGG + Intergenic
1039559781 8:38503808-38503830 TTCCTGCCCTTGCTGGAAGCGGG - Intergenic
1040582293 8:48707791-48707813 CTCCTGTCCCTGGGTCTAGCTGG + Intergenic
1040582307 8:48707854-48707876 CTCCTGTCCCTGGGTCTAGCTGG + Intergenic
1040582320 8:48707916-48707938 CTCCTGTCCTTGGGTCTAGCTGG + Intergenic
1040582332 8:48707978-48708000 CTCTTGTCCTTGGGTCTAGCTGG + Intergenic
1040722123 8:50337472-50337494 CTCCTTTCCTTGCAGGAAACGGG - Intronic
1041596903 8:59665782-59665804 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1041650185 8:60294620-60294642 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1042079884 8:65040107-65040129 TTTCTGTCTTTGGGGGAAGTTGG + Intergenic
1042933938 8:74039940-74039962 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1043989031 8:86729847-86729869 CTGCTGTCCATGTGTGAAGCTGG - Intronic
1044466730 8:92515495-92515517 CTCCTGTCCTTCAGTGAATCGGG - Intergenic
1044932687 8:97265253-97265275 CTGCTGTCCATGTGGGAGGCTGG + Intergenic
1044953425 8:97455527-97455549 CACCTGTCGTGGGAGGAAGCTGG - Intergenic
1045297182 8:100882345-100882367 CTCCTGTTCTTTGGTGAAGGTGG + Intergenic
1046076216 8:109315288-109315310 ATCCTGTGCTTGGGAGAAACAGG - Intronic
1046413882 8:113884739-113884761 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1047679827 8:127243206-127243228 ATCCTGAGCTTGGAGGAAGCCGG - Intergenic
1048042732 8:130746865-130746887 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1049005412 8:139852410-139852432 CTCCTGTCCAGTGGGGAAGGCGG - Intronic
1049234572 8:141506093-141506115 CTGCTGTGCCTGGGGGAAGCCGG - Intergenic
1049357279 8:142195143-142195165 CCCCTGCCCTTGGGGACAGCTGG - Intergenic
1049423101 8:142525441-142525463 CTCCTGTCCTTGGGGCCACGTGG + Intronic
1049423202 8:142525894-142525916 CTCCTCTGCTGGGGGGAAGGAGG - Intronic
1049463837 8:142742146-142742168 CCCCTGTCCCAGGGTGAAGCTGG + Intronic
1049635019 8:143683485-143683507 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1049748977 8:144274693-144274715 CTGCTGTGCTGGGAGGAAGCCGG - Intronic
1049768246 8:144365724-144365746 CTCCTTTCCTTGGAGGAGTCAGG + Intergenic
1049869345 8:144961372-144961394 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1052590533 9:30487951-30487973 GTCTTGTCATTTGGGGAAGCTGG - Intergenic
1052987036 9:34495293-34495315 CTCCTGGCCCTGGGAGATGCAGG - Intronic
1054792090 9:69265901-69265923 CTCCTATCCTTGTGGGAGCCTGG + Intergenic
1055310586 9:74975502-74975524 ATGCTATCTTTGGGGGAAGCTGG + Intergenic
1056800200 9:89685781-89685803 GTCCTGTTCTTTGGGGGAGCTGG + Intergenic
1058294944 9:103294608-103294630 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1060038984 9:120283564-120283586 CTCCTGACCCTGGGAGATGCAGG + Intergenic
1061066309 9:128279782-128279804 CTCCTTTCCTTGGAGGAGTCAGG - Intronic
1061227387 9:129288660-129288682 CTGCTTTCCCTGGGGGAACCTGG + Intergenic
1061375627 9:130222828-130222850 CTCCTGCCCAGGGTGGAAGCAGG + Intronic
1061763646 9:132868038-132868060 TCCCTCTCCTTGTGGGAAGCCGG + Intronic
1061799326 9:133105482-133105504 CTCCTGTCCCTGGGGTAGGCAGG + Intronic
1061832794 9:133306407-133306429 GTTTTGTCCTGGGGGGAAGCCGG - Intergenic
1062377715 9:136270690-136270712 CTCCTTTCCTTGGAGGAGTCAGG - Intergenic
1062697170 9:137881328-137881350 CTCCTGTCCTGTGGTGGAGCTGG - Intronic
1186433615 X:9524993-9525015 CACCTGTCCTTGGAGGGAGTTGG + Intronic
1187324987 X:18278424-18278446 CACATGTCCATGGGGGATGCAGG - Intronic
1187325024 X:18278590-18278612 CTCCAGTCCCATGGGGAAGCTGG - Intronic
1192440602 X:71170853-71170875 CTGTTGGCCTTTGGGGAAGCAGG - Intronic
1197086322 X:122480235-122480257 TTCATGTCCTTGGGTGAAGCTGG - Intergenic
1197764541 X:130051347-130051369 CTCCTACCCTTGGGGGAAGCTGG + Intronic
1197891462 X:131274379-131274401 CTCCTTTCCTTGGGGAAAAGAGG + Intronic