ID: 1032268566

View in Genome Browser
Species Human (GRCh38)
Location 7:130384665-130384687
Sequence CAGTGGTGAGGAGCCATTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032268566_1032268577 20 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268577 7:130384708-130384730 CCTGCCCCTGCAGTGAGGGGAGG 0: 1
1: 1
2: 3
3: 49
4: 430
1032268566_1032268574 16 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268574 7:130384704-130384726 CTCTCCTGCCCCTGCAGTGAGGG 0: 1
1: 0
2: 6
3: 38
4: 339
1032268566_1032268581 25 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268581 7:130384713-130384735 CCCTGCAGTGAGGGGAGGGTTGG 0: 1
1: 0
2: 5
3: 59
4: 486
1032268566_1032268578 21 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268578 7:130384709-130384731 CTGCCCCTGCAGTGAGGGGAGGG 0: 1
1: 0
2: 3
3: 46
4: 446
1032268566_1032268584 27 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268584 7:130384715-130384737 CTGCAGTGAGGGGAGGGTTGGGG 0: 1
1: 0
2: 9
3: 75
4: 708
1032268566_1032268583 26 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268583 7:130384714-130384736 CCTGCAGTGAGGGGAGGGTTGGG 0: 1
1: 0
2: 2
3: 71
4: 416
1032268566_1032268585 28 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268585 7:130384716-130384738 TGCAGTGAGGGGAGGGTTGGGGG 0: 1
1: 1
2: 6
3: 101
4: 744
1032268566_1032268573 15 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268573 7:130384703-130384725 TCTCTCCTGCCCCTGCAGTGAGG 0: 1
1: 0
2: 6
3: 35
4: 370
1032268566_1032268575 17 Left 1032268566 7:130384665-130384687 CCTCGAATGGCTCCTCACCACTG 0: 1
1: 0
2: 1
3: 10
4: 97
Right 1032268575 7:130384705-130384727 TCTCCTGCCCCTGCAGTGAGGGG 0: 1
1: 0
2: 1
3: 61
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032268566 Original CRISPR CAGTGGTGAGGAGCCATTCG AGG (reversed) Intronic
902998507 1:20247179-20247201 CAGGGATGAGGAGCCAATCGGGG + Intergenic
903061366 1:20670960-20670982 CAGAGGTGAGGAGGCTTTCAAGG + Intronic
904005501 1:27361139-27361161 CAGTGGTGCGCAGCCTTTCATGG - Exonic
904015412 1:27416263-27416285 AAGTAGAGAGGTGCCATTCGGGG - Intronic
904352208 1:29915853-29915875 CAGAGGTGAGGAGCCATGCAGGG - Intergenic
906246314 1:44276961-44276983 CAGTGTTGAGGATCCAGTTGAGG - Intronic
906713544 1:47950877-47950899 CAGTGGTGAGGGGGCACTGGTGG + Intronic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
916761018 1:167818071-167818093 CAGTGGGGAGGAGCTACTCAAGG - Exonic
918054834 1:181011782-181011804 CAGTGGTGGGTAGACATTTGTGG - Intronic
920191217 1:204195061-204195083 CAGTGGGAAGGAGGCACTCGGGG - Intronic
920711183 1:208296497-208296519 CACTGGTGACCATCCATTCGTGG + Intergenic
922915339 1:229252797-229252819 CAGACGTGGGGAGCCATTAGGGG - Intergenic
1062882134 10:987900-987922 CCGTGGTGAGGAGGCCCTCGCGG - Intergenic
1068793601 10:61053446-61053468 CAGTTGTGTGGAGGCATTAGAGG + Intergenic
1071431229 10:85608656-85608678 CAGAGGTGAGGAGGCACTGGTGG + Intronic
1074113968 10:110442037-110442059 CAGTGGTGTGGTGCGTTTCGTGG - Intergenic
1074226946 10:111493999-111494021 AAGTTGTGAGGACCCATTCAAGG - Intergenic
1077510660 11:2960138-2960160 TATTGGTGAGGAGGCATTGGAGG - Intronic
1081072722 11:38630707-38630729 CAGTGGTGTGGGGCCTGTCGAGG + Intergenic
1082205619 11:49430467-49430489 AAGCTGTGAGGAGCCATTGGAGG + Intergenic
1086649480 11:89270049-89270071 AAGCTGTGAGGAGCCATTGGAGG - Intronic
1086890779 11:92255539-92255561 CAGTGGAGAGGAGCCATTATGGG + Intergenic
1091284210 11:134399092-134399114 CAGGCGAGAGGAGCCATTCTGGG - Intronic
1093005306 12:14044790-14044812 AAGTGGGGAGGAGCCATTGCAGG - Intergenic
1095917566 12:47495662-47495684 CAGTTGTGGGGAGCCAGTGGGGG - Intergenic
1097564710 12:61252842-61252864 CAGTGGTGTGGGGCCTGTCGAGG - Intergenic
1101892697 12:108731142-108731164 CTGTGGGGAGGAGGCTTTCGAGG - Intronic
1103082859 12:118039169-118039191 CAGTGGTGTGGAGTCACTAGGGG + Intronic
1103257459 12:119554351-119554373 CAGTGGTCAGTAGCCACACGTGG - Intergenic
1110052816 13:70924590-70924612 CAGTGGCGAGGAGCCGTCCGAGG + Intergenic
1115059651 14:29173481-29173503 CAGTGGTGTGGGGCCTGTCGAGG + Intergenic
1115976682 14:39004464-39004486 TAGTGGAGAGGAGCCAGTCAGGG + Intergenic
1119023173 14:71132213-71132235 AAGTGGTGAGCAGCCATACCTGG - Intergenic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1125525019 15:40369139-40369161 CAGTGTTGAGCTGCCACTCGAGG - Exonic
1125909405 15:43422578-43422600 GAGTGGTCAGGAGCCCTTCTAGG + Intronic
1131593784 15:93775905-93775927 CACTGGTGAGGAGCCATAGGAGG + Intergenic
1132385662 15:101398247-101398269 CAGTGTGGAGGAGTCACTCGGGG - Intronic
1138514762 16:57529869-57529891 CAGTGGTCAGGACCCAGTCCTGG - Intronic
1141282320 16:82639866-82639888 CAGTGGTGAGGACCCTGTCAAGG - Intronic
1142216142 16:88831053-88831075 GTGTGGTGAGGAGACATCCGTGG - Intronic
1142851532 17:2707088-2707110 CAGGGGTGGGGAGACCTTCGGGG - Intronic
1143775004 17:9193583-9193605 CAGCTGTGAGGAGACATTTGGGG - Intronic
1144637595 17:16920209-16920231 GAGTGGGGAGGAGCCAATCTCGG - Intergenic
1151927718 17:77211121-77211143 CAGTGGTGAGGTGGCAGTGGTGG + Intronic
1152781976 17:82230726-82230748 CAGTGGCGCAGAGCCATTGGAGG + Intronic
1153317901 18:3742293-3742315 CGGTGGTCAGGAGCCATTAGTGG - Intronic
1157302948 18:46492985-46493007 CAGTGATGAGGAGCCATTGGGGG - Intronic
1162554852 19:11380546-11380568 CAGGGGTGCGGAGGCATTCAGGG + Intronic
929053263 2:37855691-37855713 CAGAGGTGAGAAGCCAGTCTTGG - Intergenic
938400487 2:130987078-130987100 CAGTGGGGAGGAGCCACTGCAGG + Intronic
939426144 2:142039267-142039289 CAATGGGGAGGAGCCATCTGTGG - Intronic
941699843 2:168592601-168592623 CAGTGGGGAGGAGCAATTTCAGG + Intronic
1169072329 20:2740384-2740406 CAGTGCTTAGTAGCCATGCGTGG + Intronic
1177058358 21:16338027-16338049 AACTGGTGAGGAGGCATTCAGGG + Intergenic
1177347076 21:19887183-19887205 AGGTGGTGAGGGGCCATTGGTGG - Intergenic
1179559204 21:42202106-42202128 CAGGGGTGGGGATCCATCCGTGG - Intronic
1179839021 21:44058342-44058364 CAGCGGTGAGGAGGCCTTGGTGG + Intronic
1180663488 22:17489733-17489755 CAGGCGTGAGCAGCCATTCCAGG + Intronic
1181102715 22:20552181-20552203 CAGTGGGCAGGAGCCATTGTTGG - Intronic
1182465935 22:30516204-30516226 CAGTGGTGGGGAGCCATGGAAGG + Intergenic
1182551006 22:31100681-31100703 CAGTGGGGAGGAGGCATGCGGGG + Intronic
1184333789 22:43841537-43841559 CAGGGCTGAGGGGCCATTTGTGG - Intronic
1185397953 22:50602009-50602031 AAGTGGGGAGGAGCCATCAGAGG - Intronic
952203330 3:31152901-31152923 CAGTGGTGGGGGGCAATTGGTGG + Intergenic
954923585 3:54213148-54213170 CAGTGATCAAGAGCCATTTGTGG - Intronic
963766585 3:149342866-149342888 CATTAGTCAGGAGCCATTCAGGG + Intergenic
963858216 3:150278848-150278870 CAAAGGGGAGGAGACATTCGGGG - Intergenic
966445628 3:179998143-179998165 CAGTGGTGTGGGGCCTGTCGAGG + Intronic
971099490 4:23447598-23447620 CAGTGGTGATGAGCACTTGGGGG + Intergenic
975613014 4:76219807-76219829 CAGTGGTTAGAAGTCATGCGGGG - Intronic
979446309 4:120816435-120816457 CACTGGTGAGGAGTCGTTGGAGG - Exonic
979852114 4:125585376-125585398 CAGTGGTCAGCAGACATCCGGGG + Intergenic
985109670 4:186535798-186535820 TTGATGTGAGGAGCCATTCGAGG - Intronic
988951902 5:36270934-36270956 CAGTGGTGAGGACTCATATGAGG + Intronic
995710242 5:115027730-115027752 CAGTGATGGGGAGCTATTGGAGG - Intergenic
1001211239 5:169812067-169812089 CAGGGTTGAGGACCCATTCTGGG - Intronic
1005142326 6:22647021-22647043 CAGTGGTGAGCTGCCATGCTTGG - Intergenic
1006404200 6:33834717-33834739 CAGTGGGAAGGCGCCGTTCGAGG + Intergenic
1006736057 6:36273411-36273433 CAGTGGGGAAGAGCCATTAATGG - Intronic
1012362200 6:98396297-98396319 CAGTAGTGAAAAGCCATTTGAGG - Intergenic
1014149597 6:118038762-118038784 CAGTTGTGAGCAACCATTCATGG + Intronic
1018938196 6:168287747-168287769 CAGTGGTGAGGGACCATATGGGG + Intergenic
1021935876 7:25630792-25630814 CAGTGGTAAGGAGCAATTTCTGG - Intergenic
1021937341 7:25644299-25644321 CTGTGGTGAGAAGCCAGTGGAGG - Intergenic
1022178902 7:27899187-27899209 TAGTGGCAAGGAGCCATTTGGGG + Intronic
1023069250 7:36412747-36412769 CAGTGGGGAGGAGCCAGGTGAGG - Intronic
1028117229 7:87012439-87012461 CTGTGGTTAGTAGCCATTTGTGG - Intronic
1029422293 7:100477844-100477866 AGGTGGTGGGGAGCCATTCCGGG + Exonic
1030087935 7:105833041-105833063 GTGTGGTGAGAAGCCATTAGAGG - Intronic
1031961156 7:127991236-127991258 CAGTGGAGGGGAGCAATTTGGGG - Intronic
1032268566 7:130384665-130384687 CAGTGGTGAGGAGCCATTCGAGG - Intronic
1033678906 7:143573373-143573395 CAATGGTGCGGGACCATTCGGGG - Exonic
1033692932 7:143756081-143756103 CAATGGTGCGGGACCATTCGGGG + Exonic
1034483600 7:151341961-151341983 CGGGGGTGAGCAGCCATGCGTGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1041765577 8:61414981-61415003 CAGTAGTTAGGAGCCATTTGAGG + Intronic
1044587765 8:93884021-93884043 CAGTGGGGAGGCCGCATTCGAGG - Intronic
1045014751 8:97991170-97991192 CAGTAGTCAGGAGCCACACGTGG + Intronic
1049464028 8:142742995-142743017 CAGTGATGAGGGGCCACTCCTGG - Intergenic
1051337763 9:16081892-16081914 CAGTGGAGAAGAGTCATTCGAGG - Intergenic
1051444672 9:17127568-17127590 CAGTGGTAAGGTGCCATTTTAGG - Intergenic
1052365657 9:27609207-27609229 CAGTGGTGAGGGACCATATGGGG + Intergenic
1059884470 9:118730135-118730157 TAGTGGTGTGGACCCATTCATGG - Intergenic
1062095265 9:134699873-134699895 CAGAGGTGAGAAGGCAGTCGGGG - Intronic
1192198752 X:69050147-69050169 GAGAGATGAGGAGCCATTGGAGG + Intergenic
1192456416 X:71280111-71280133 CAGTGATGGGGAGCCATTGAAGG - Intergenic
1199979450 X:152912953-152912975 CAGTGATGAGGTGCCATTCCTGG + Intergenic