ID: 1032271657

View in Genome Browser
Species Human (GRCh38)
Location 7:130413641-130413663
Sequence CTGAGCTATAACTCACATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032271657 Original CRISPR CTGAGCTATAACTCACATAT AGG Intronic
903617361 1:24670425-24670447 CAGATGTATAACTCACAAATGGG - Intronic
909724127 1:78813181-78813203 CTGAGCCAGAACTCACAGAAGGG + Intergenic
916859187 1:168785036-168785058 TAGAACTATAACTCAAATATTGG + Intergenic
923241150 1:232086953-232086975 CTCAGCCATTACTCTCATATTGG - Intergenic
1063698147 10:8357463-8357485 CTGACCTATAATTCTCAAATGGG - Intergenic
1065063064 10:21928158-21928180 AGGAGCTATTACTGACATATGGG + Intronic
1065932275 10:30490504-30490526 CTCTGCTATAGCCCACATATGGG - Intergenic
1068823374 10:61404345-61404367 CTGAAGTAAAACTCACAAATTGG + Intergenic
1071090731 10:81914888-81914910 ATAATCTATAACTCACATAAAGG - Intronic
1072312312 10:94168198-94168220 CTCAGCTGTAACTCACCTCTGGG - Intronic
1077165511 11:1133855-1133877 CTGAGTTAAAAGTCACATATAGG + Intergenic
1077396468 11:2325935-2325957 CTGAGCTATGAGTCACCTACTGG - Intergenic
1082203142 11:49398160-49398182 CTGAGCAGTAACTCACCTGTAGG - Intergenic
1086978816 11:93170554-93170576 CTCAGTTTTAACTCACACATTGG - Intronic
1088517569 11:110655415-110655437 CCTAGCTGTAATTCACATATAGG - Intronic
1089657706 11:119963657-119963679 CAGAGCTAGAACTCACACACAGG - Intergenic
1089761505 11:120728170-120728192 CTAAGCTAAAAGTGACATATAGG + Intronic
1095355807 12:41273502-41273524 CTTAACTGTAACTTACATATAGG + Intronic
1099241051 12:80139380-80139402 CTGAGCCTTAACTTACACATTGG + Intergenic
1102634688 12:114312627-114312649 CTTAGCTTTAACTAGCATATAGG - Intergenic
1102639395 12:114353449-114353471 TTGAGCTCTAAAACACATATGGG - Intergenic
1103791451 12:123474684-123474706 CAGAGCCATAATTCACATAGTGG - Intronic
1106958328 13:34968622-34968644 TTGAGCTAGAACTGACCTATAGG + Intronic
1110077866 13:71272379-71272401 CTAAGGTATAACTCTCATAATGG - Intergenic
1117426600 14:55605005-55605027 CTGATCTAGAACTCCCAGATAGG + Intronic
1120418524 14:84252137-84252159 CAGAGCTATAACTAACCCATTGG - Intergenic
1124409456 15:29424134-29424156 ATGAGCTATAACTCACATTGAGG - Intronic
1130426897 15:83810571-83810593 CTGGGCTAAAACTAACATATAGG + Intronic
1131274556 15:90970069-90970091 CTGGGCTAGAACCCACATGTAGG + Intronic
1134052458 16:11146354-11146376 CTGGGCTATACCAGACATATAGG + Intronic
1137591967 16:49699268-49699290 CTGAGCTGTAACTCTAATAAAGG + Intronic
1137652816 16:50135015-50135037 CTGAGCTATAATCCACCTACAGG + Intergenic
1138355305 16:56373033-56373055 CTGACTTATAACTGACAAATTGG + Intronic
1142687785 17:1587626-1587648 CAGAGCCAGCACTCACATATGGG - Intronic
1146564798 17:33903379-33903401 GTGAGCTATAAAACACATTTTGG - Intronic
1153553804 18:6289607-6289629 CTGACCTATAAATCACATGCAGG - Intronic
1156299045 18:35819219-35819241 CTGAGCTATCACTGAAGTATGGG + Intergenic
1159145569 18:64449827-64449849 CTCAGCTATAACATACATTTTGG + Intergenic
1159193303 18:65077714-65077736 ATGAGATATAACACACAGATAGG + Intergenic
1165965151 19:39571118-39571140 CTGTGCTATGACTCACCTATAGG - Intergenic
926643307 2:15260995-15261017 CTGAGTTATAACTCACTAGTGGG - Intronic
933009806 2:77046122-77046144 GGGAGCTAAAACTCACATCTTGG + Intronic
933325997 2:80837929-80837951 TTCAGATATAACACACATATTGG + Intergenic
935788356 2:106569359-106569381 CTGAGCTATAACCCACGTGCAGG + Intergenic
936245822 2:110826510-110826532 CTGGGCAATAACACACCTATGGG - Intronic
938656720 2:133442367-133442389 CTCAGCAATGACTCACAGATGGG - Intronic
939662987 2:144913592-144913614 CTGAGCTATAGTTCAAATTTGGG + Intergenic
940398177 2:153217783-153217805 CTTAGGTATAACACAGATATTGG - Intergenic
942745846 2:179231179-179231201 CTGAGCTATATCTAACCAATAGG + Intronic
945589565 2:211713519-211713541 CTGAGCTACCACTCACCTTTTGG + Exonic
948116685 2:235498676-235498698 CTGGGCTATCACTCACATCACGG - Intronic
948407274 2:237731499-237731521 CTGAGTCAAAATTCACATATTGG - Intronic
1172167717 20:32909040-32909062 CTGAGCCACAACCCACAGATGGG + Intronic
1172606984 20:36220696-36220718 CTGAGCTCTAACTCACACCCTGG - Intronic
1179910792 21:44447114-44447136 CTGAGATATAATTCACAAATAGG - Intergenic
1181370085 22:22408975-22408997 CTGAGCTGTGTCTCACATACAGG - Intergenic
1184104665 22:42360360-42360382 CTGAGCTAGAAATCACAAAGTGG - Intergenic
951956949 3:28267566-28267588 CAGAGCTATATCCCACTTATTGG - Intronic
956729162 3:72180874-72180896 TTCAGGTATAACTTACATATAGG - Intergenic
958544377 3:95522887-95522909 CTGAGATATTACTCCCATGTTGG - Intergenic
960405012 3:117249124-117249146 CTGAGCTAAAACTGAAATACTGG - Intergenic
963761662 3:149291432-149291454 CTGAGCCACACCTGACATATTGG + Intergenic
965217845 3:165887043-165887065 ATTATCTATAACTTACATATAGG - Intergenic
968971179 4:3796029-3796051 CTTAGCTTTAAATCACATAAAGG - Intergenic
971660372 4:29406922-29406944 ATGAGCTATTCCTCACATAGAGG - Intergenic
974286900 4:59880714-59880736 CTGACCTACAAATCACATGTTGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
982492092 4:156042104-156042126 CTGAGCTATCACTTCAATATGGG - Intergenic
983084743 4:163428999-163429021 ATGAGCTTTAACTAACATAAAGG + Intergenic
983207471 4:164926139-164926161 CTAAGCTATGACACACATGTAGG - Intergenic
983475678 4:168208908-168208930 CAGATTTATAACTCACAGATAGG - Intergenic
984514283 4:180719358-180719380 CTGAGCAATAACTGACCTGTTGG + Intergenic
988289083 5:29261512-29261534 CTGAGCTAAAACTCAAATGAAGG - Intergenic
990144250 5:52741255-52741277 CTGAGGTATATTTTACATATTGG - Intergenic
994447878 5:99900727-99900749 ATGAGCCATGACTCACATGTTGG - Intergenic
995566570 5:113437044-113437066 CTGGGCCATTAGTCACATATTGG + Intronic
998023533 5:138792670-138792692 ATGAGCTTGATCTCACATATGGG + Intronic
1007183288 6:39946208-39946230 CAGAGCTATGCCTGACATATTGG + Intergenic
1009187392 6:60589599-60589621 CTGAGCTCCAACTCCAATATTGG + Intergenic
1009580522 6:65527323-65527345 CTGGGGTATGACTCACGTATGGG + Intronic
1011136599 6:84107013-84107035 TTGAGCTTCAATTCACATATAGG + Intergenic
1013825912 6:114211377-114211399 CTGAGGAATAACTCACACAATGG - Intronic
1014952646 6:127576247-127576269 CTCAGGTAAAACTCAGATATAGG + Intronic
1020269546 7:6585847-6585869 CTGATATAAAATTCACATATTGG + Intronic
1021049374 7:15963738-15963760 ATGAGCTATTTCTAACATATTGG + Intergenic
1023459248 7:40377022-40377044 TTGAGCTATAGTTCCCATATAGG + Intronic
1032271657 7:130413641-130413663 CTGAGCTATAACTCACATATAGG + Intronic
1033198356 7:139346722-139346744 CTCAGCTATAACCCACAGAGAGG + Intronic
1033249217 7:139744562-139744584 TTGAGATATAACTCACATACCGG - Intronic
1041803006 8:61820289-61820311 CAGAGCTTTCTCTCACATATTGG - Intergenic
1045160383 8:99535622-99535644 GTGAGTTACAACTTACATATAGG + Intronic
1046380840 8:113448380-113448402 ATCAGGTATAACTCAGATATGGG - Intergenic
1053610810 9:39711352-39711374 CTGTGCTGTTACTCACTTATAGG - Intergenic
1053868846 9:42469374-42469396 CTGCGCTGTTACTCACTTATAGG - Intergenic
1054087444 9:60759806-60759828 CTGTGCTGTTACTCACTTATAGG + Intergenic
1054242712 9:62631043-62631065 CTGTGCTGTTACTCACTTATAGG + Intergenic
1054556837 9:66665561-66665583 CTGTGCTGTTACTCACTTATAGG + Intergenic
1056297078 9:85204005-85204027 CTGAAATATCAGTCACATATAGG - Intergenic
1185469252 X:372998-373020 TTGAGATATCACTCACATACCGG - Intronic
1188030488 X:25258255-25258277 CTGAGCTGTCATTCAGATATTGG - Intergenic
1197677534 X:129346707-129346729 CTGTGCTAGAACTCACCTACAGG - Intergenic
1199246935 X:145616122-145616144 CTGAGCTAAAATTCAGATCTGGG - Intergenic