ID: 1032272733

View in Genome Browser
Species Human (GRCh38)
Location 7:130425631-130425653
Sequence GTGCTCAGGAGTACAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032272733_1032272735 3 Left 1032272733 7:130425631-130425653 CCAGCAGTTGTACTCCTGAGCAC 0: 1
1: 0
2: 4
3: 56
4: 339
Right 1032272735 7:130425657-130425679 TCCCAGAGAAATGAAGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032272733 Original CRISPR GTGCTCAGGAGTACAACTGC TGG (reversed) Intronic
900952754 1:5867219-5867241 GTGCTCAGCAAGACACCTGCTGG + Intronic
901127847 1:6941782-6941804 GGGCACAGGAGCAGAACTGCAGG - Intronic
901268125 1:7928270-7928292 ATGCTCAGGAGTGCAATTGCTGG - Intronic
901731309 1:11282100-11282122 ATGCCCAGGAGTAGAATTGCTGG + Intronic
902189012 1:14747718-14747740 ATACTCAGGAGTGGAACTGCTGG + Intronic
902779239 1:18693744-18693766 GTGCCCAGGAGAACAGCTGCAGG - Intronic
902972676 1:20065790-20065812 ATACTTAGGAGTACAATTGCTGG + Intronic
903591547 1:24459875-24459897 GAGCTCAGGAATACAGCTGGAGG + Intronic
904802955 1:33108882-33108904 ATACTAAGGAGTACAATTGCTGG + Intronic
905312150 1:37056727-37056749 GTGCTCAGGAGCACGGCAGCAGG + Intergenic
905379593 1:37551864-37551886 ATGCTCAGGAGTACAATTGCTGG - Intronic
906435302 1:45790783-45790805 ATGCTCAGTAGTGCAATTGCTGG + Intronic
908555235 1:65250941-65250963 GTACACAAGAGTGCAACTGCTGG + Intronic
908989333 1:70066742-70066764 ATGTCCAGGAATACAACTGCTGG + Intronic
910634941 1:89397231-89397253 ATGCTCAGCAGTAGAATTGCTGG + Intergenic
910949127 1:92626534-92626556 ATACTTAGGAGTAGAACTGCTGG + Intronic
910976474 1:92911673-92911695 ATGCTCAGGAGTATAATTGCTGG + Intronic
911715794 1:101131375-101131397 TTGCTCAGGCGTAGAACTGAGGG + Intergenic
912054675 1:105580055-105580077 ATGTTCAGGAGTACAGTTGCTGG - Intergenic
912592631 1:110841161-110841183 GTGCCCAGGAGCACAATTGCTGG - Intergenic
913307314 1:117444356-117444378 GTTCTCAAGAATACAATTGCTGG + Intronic
913458634 1:119060061-119060083 AAGTTCAGGAGTACAAGTGCAGG - Intronic
915178617 1:154038672-154038694 GAGCTCAGGAGTTCAAGTCCAGG - Intronic
915254885 1:154619909-154619931 GTACCCAGGAGTATAAATGCTGG - Intronic
916643491 1:166757876-166757898 ATACTCAGGAGTAGAATTGCTGG + Intergenic
916949513 1:169764863-169764885 ATGCTCAAGAGTACAATTGCTGG - Intronic
917051093 1:170924348-170924370 AAGTTCAGGAGTACAAGTGCAGG - Intergenic
917844882 1:179012210-179012232 ATTCCCAGGAGTAAAACTGCTGG - Intergenic
918960059 1:191263142-191263164 ATGCCCAGAAATACAACTGCTGG + Intergenic
919420110 1:197359608-197359630 ATGCCCAGGAGTAAAATTGCTGG + Intronic
919572577 1:199267486-199267508 GACCTCAGTACTACAACTGCAGG + Intergenic
920981458 1:210840315-210840337 GCAATCAGGAGAACAACTGCTGG - Intronic
921120614 1:212133419-212133441 ATGCCCAGGAGTACACTTGCTGG - Intergenic
922583789 1:226718847-226718869 ATGCTCAGGAGTGCAGTTGCTGG - Intronic
922588211 1:226751839-226751861 GTACTCAGGAGAACAAGTGAAGG - Intergenic
923398059 1:233587255-233587277 GTGCTCTAGAGTACATCTTCAGG - Intergenic
1063583202 10:7327977-7327999 ATACCCAGGAGTACAATTGCTGG + Intronic
1066256903 10:33688582-33688604 GTACTCAGGAATGCAATTGCTGG + Intergenic
1066362990 10:34748898-34748920 GTGTTGATGAGTACAACTGAGGG - Intronic
1069552599 10:69375003-69375025 GTGGTTAGGAGTACAACTTCTGG + Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1072081846 10:92040681-92040703 ATGCCCAGGAGGGCAACTGCAGG - Intergenic
1072622439 10:97089004-97089026 CTGCCCAGGAGTGCACCTGCAGG - Intronic
1075245198 10:120815968-120815990 AAGCTCAGGGGTACAAGTGCAGG + Intergenic
1075815092 10:125258981-125259003 GTGCTCAGGAGTCCAACACCTGG + Intergenic
1075839744 10:125490739-125490761 GTGCTCAGGAGTTCAGGTACTGG + Intergenic
1075863011 10:125693813-125693835 ATTCTCAGGAGTAGAATTGCTGG - Intergenic
1076024970 10:127103807-127103829 GTGGCCAGGAGTACAATGGCTGG + Intronic
1076213638 10:128674251-128674273 GTGCCAAGGAGTAGAATTGCTGG - Intergenic
1078206283 11:9232700-9232722 ATGCTCAGGAGTGGAATTGCTGG - Intronic
1078963314 11:16305531-16305553 GTACCCAAGAGTACAATTGCTGG - Intronic
1079122931 11:17697970-17697992 GGGCTCAGGAGCCCAAGTGCTGG + Intergenic
1081024667 11:37996025-37996047 GGGTTCAGGGGTACAAGTGCAGG + Intergenic
1083387992 11:62326468-62326490 AAGTTCAGGGGTACAACTGCAGG - Intergenic
1083657430 11:64236229-64236251 GTGCTCAGGAGAAGAACAGGGGG - Intronic
1085540670 11:77266172-77266194 ATGCCCAGGAGTACAATTTCTGG + Intronic
1086187588 11:84037988-84038010 AAGTTCAGGAGTACAAGTGCAGG + Intronic
1086344145 11:85878690-85878712 ATGCCCAGGAGTTCAATTGCTGG + Intronic
1087697914 11:101402048-101402070 GTGTTCAGGGGTACATGTGCAGG - Intergenic
1087863513 11:103194428-103194450 ATGCTCAGGAATGCAATTGCAGG + Intronic
1088207389 11:107409053-107409075 GTGCTTAGGGGATCAACTGCAGG + Intronic
1088332773 11:108670479-108670501 GGGCTCAGCAGTGCTACTGCAGG - Intronic
1090272233 11:125395432-125395454 ATGCCCAAGAGTACAATTGCTGG + Intronic
1094366046 12:29682363-29682385 GTGCCCAGGAGTGCAACTGATGG - Intronic
1094374942 12:29780129-29780151 ATGCCCAGGAGTCCAATTGCTGG - Intronic
1094483776 12:30907594-30907616 GTGTCCAGGAGTACAATTGATGG - Intergenic
1095587968 12:43869773-43869795 GAGTTCAGGTGTACATCTGCAGG + Intronic
1098375715 12:69811370-69811392 AAGTTCAGGAGTACAACTGCAGG - Intronic
1098594136 12:72251676-72251698 ATGCTGATGAGTAGAACTGCTGG + Intronic
1099206657 12:79736329-79736351 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1099288142 12:80740499-80740521 AAGCTCAGGAGTACAAGTGCAGG - Intergenic
1100036912 12:90263010-90263032 AAGCTCAGGAGTACATATGCAGG - Intergenic
1100051191 12:90449825-90449847 GTGCCCAGGAATGCAATTGCAGG + Intergenic
1100914563 12:99404293-99404315 GAGTTCAGGAGTACATGTGCAGG - Intronic
1100988173 12:100224740-100224762 GAGCTCAGGAGTTCAACACCAGG - Intronic
1101291139 12:103370854-103370876 TAGTTCAGGAGTACAAGTGCAGG - Intronic
1101432714 12:104640207-104640229 ATACTAAGGAGTGCAACTGCTGG - Intronic
1101664364 12:106797138-106797160 ACACCCAGGAGTACAACTGCTGG - Intronic
1101847360 12:108373280-108373302 GGGCTCAGGAGTGGAAATGCAGG - Intergenic
1102189447 12:110975584-110975606 GTACCCAGGAGTAGAAATGCTGG - Intergenic
1103011058 12:117458744-117458766 GAGCTCAGGAGTAGAGCTGGTGG + Exonic
1103705985 12:122872758-122872780 ATGCCCAAGAGTACAACTTCTGG - Intronic
1103936105 12:124477729-124477751 GTCATCAGGAGTGCACCTGCAGG - Intronic
1104057830 12:125244266-125244288 ATGCTCAGGAGTGGAATTGCTGG + Intronic
1105667097 13:22572236-22572258 GTACTGAGGAGTAGAATTGCTGG - Intergenic
1108250274 13:48559983-48560005 TTGATCAAGAGTACAATTGCTGG - Intergenic
1108269242 13:48742577-48742599 ATGTCCAGGAGTTCAACTGCTGG + Intergenic
1113924578 13:113934334-113934356 ATGCCCAGGAGTACAATCGCTGG + Intergenic
1115052194 14:29076348-29076370 GTGCTCAAGAGAGCAACTGCTGG - Intergenic
1116626737 14:47274588-47274610 ACGCTAAGGAGTAAAACTGCTGG + Intronic
1116895905 14:50314596-50314618 GTGCCCAAGAGTACAATTGCTGG + Intronic
1117236147 14:53778250-53778272 ATGCCCAGGAGTACAATTTCTGG - Intergenic
1117902021 14:60544223-60544245 GTCCTCAGGATTCCAACTACAGG - Intergenic
1118900967 14:69985375-69985397 ATGCTCAGGAGTGCAACTGCTGG - Intronic
1119892800 14:78195634-78195656 GAGCTGAGGAGAGCAACTGCGGG + Intergenic
1120453357 14:84699755-84699777 GTGCTCAGAATTACAGCTGCTGG - Intergenic
1120857144 14:89222616-89222638 GAGCTCAGGAGGACACCTGTTGG + Intronic
1121141467 14:91546203-91546225 ATGCCCAGGAGTAAAATTGCTGG - Intergenic
1122970873 14:105151732-105151754 GTGCTCAGCTGTAGAACCGCGGG + Exonic
1123045941 14:105514711-105514733 ATGTTCAGGAGTACATGTGCAGG - Intergenic
1124011270 15:25840669-25840691 ATGCCCAGGAGTGCAACTGGTGG + Intronic
1124389702 15:29242984-29243006 GTGCCCAGGAGTACCACTGCAGG + Intronic
1124408255 15:29411208-29411230 ATGCTTATGAGTAGAACTGCAGG + Intronic
1124553256 15:30701978-30702000 GTGCTCAGGAATCCAGTTGCTGG + Intronic
1124677985 15:31703694-31703716 GTGCTCAGGAATCCAGTTGCTGG - Intronic
1125310285 15:38371815-38371837 CTGCTCTAGAGTACAACTGAAGG + Intergenic
1126202910 15:46007991-46008013 GTGCCTAGGAGTAGAATTGCTGG + Intergenic
1127155288 15:56117978-56118000 ATGCTCAGCAGTAGGACTGCTGG + Intronic
1127278319 15:57467290-57467312 GTGCTTAGGAGGAGGACTGCTGG + Intronic
1127342572 15:58063614-58063636 GAGCTGAGGAGGAAAACTGCTGG + Intronic
1127920020 15:63486997-63487019 ATCCCCAGGAGTGCAACTGCTGG + Intergenic
1128259080 15:66219736-66219758 ATGCTCAAGAGTGCAATTGCTGG - Intronic
1128534087 15:68477495-68477517 ATGCACAGGAGTGCAATTGCTGG - Intergenic
1128774086 15:70306266-70306288 GTGCCCAGAAGTACGATTGCTGG + Intergenic
1132229602 15:100171636-100171658 GTGCTCAGGAGCTCAGCTGGAGG - Intronic
1132327022 15:100980056-100980078 ATGTTCAGGAGTTCAATTGCTGG - Intronic
1133817380 16:9208493-9208515 GAGCTCAGGAGTTCAAGAGCGGG + Intergenic
1134232637 16:12440459-12440481 AAGTTCAGGAGTACAAGTGCAGG + Intronic
1134328463 16:13228718-13228740 AAGTTCAGGAGTACAAGTGCAGG + Intronic
1134773738 16:16833766-16833788 AAGCTCAGGAATACAAGTGCGGG + Intergenic
1134909543 16:18012113-18012135 ATGTTCAGGAGTATAATTGCTGG + Intergenic
1135619249 16:23940319-23940341 ATGCCCAAGAGTGCAACTGCTGG - Intronic
1137431457 16:48421190-48421212 ATGCTCAGGAGTGTAATTGCTGG - Intronic
1138311878 16:56032116-56032138 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1141458902 16:84164776-84164798 ATACTCAGGAGCACAATTGCTGG + Intronic
1141782194 16:86170230-86170252 ATGCTCAGGAGTGTAACTGCAGG + Intergenic
1142278958 16:89137836-89137858 GTGCTCATGGGCACCACTGCCGG + Intronic
1142524223 17:527454-527476 CTACTCAAGAGTAGAACTGCTGG + Intronic
1142997759 17:3771022-3771044 GTGCTCAGGAGTGGGATTGCTGG - Intronic
1143315511 17:6029377-6029399 GTGCCCAGGACTAGAATTGCTGG + Intronic
1143738275 17:8930499-8930521 ACGCTCAGGAGCACAATTGCTGG - Intronic
1145051394 17:19664648-19664670 GTGTTGGGGAGTACAACTCCAGG + Intronic
1146509501 17:33433848-33433870 ATGTTCAGGAGTACATGTGCAGG - Intronic
1147194313 17:38755182-38755204 GAGCTCAGGAGTTCAGCTGTGGG - Intronic
1147416612 17:40295870-40295892 GAGGTCTGGAGTACAACTGTGGG - Intronic
1147826235 17:43271864-43271886 GTGCTCGCAAGTGCAACTGCCGG + Intergenic
1148199124 17:45736900-45736922 ATGCCCAGAAGTACAATTGCTGG + Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1150112225 17:62511923-62511945 ATGTTCAAGAGTACAATTGCTGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151952825 17:77364635-77364657 GTGTTCAGGGGTAGAACTGTGGG - Intronic
1152911374 17:83006844-83006866 ATGCCCAGGAGAGCAACTGCCGG + Intronic
1153669560 18:7397749-7397771 ATGCTCAGGAGTGTGACTGCTGG + Intergenic
1154262123 18:12844293-12844315 ATGCCCAGGAGTGCAAGTGCTGG + Intronic
1154965584 18:21352645-21352667 GAGCTCAGGAGTTCAAGTCCAGG - Intronic
1158098325 18:53800895-53800917 AAGTTCAGGAGTACAAGTGCAGG + Intergenic
1159513425 18:69426860-69426882 AAGTTCAGGAGTACAAGTGCAGG + Intronic
1159960584 18:74552792-74552814 GTACTCAGGAATAGAATTGCTGG + Intronic
1160312101 18:77803919-77803941 GTGCTCAGGAATATAATTGTTGG + Intergenic
1162226478 19:9226911-9226933 AAGCTCAGGGGTACAAGTGCAGG + Intergenic
1162588811 19:11577639-11577661 GGGCTCTAGAGTAGAACTGCCGG + Exonic
1164177342 19:22786921-22786943 GAGCTCAGGAGTTCAAGTGCAGG + Intergenic
1165359100 19:35323353-35323375 ATGCCCAGGAGTGCAATTGCTGG + Intronic
925724087 2:6856145-6856167 GTTCCCAGGAGCAGAACTGCAGG - Intronic
925978681 2:9159125-9159147 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
926445656 2:12938727-12938749 GTACTGAGGAGTACAATAGCAGG + Intergenic
928226784 2:29456199-29456221 ATGCCCAGGAGTAGAATTGCTGG - Intronic
929368353 2:41189837-41189859 AAGTTCAGGAGTACAAGTGCAGG - Intergenic
929411418 2:41701057-41701079 ATGCTCAAGAGTTCAATTGCTGG - Intergenic
930182731 2:48380426-48380448 GTGCCCAGAAGTAAATCTGCTGG - Intergenic
931374970 2:61698770-61698792 GTGCTCAGGAGGACTCCTACAGG - Intergenic
931646508 2:64426657-64426679 ATGCCCAGGAGTAGAACTGCTGG + Intergenic
934992411 2:98930695-98930717 GTGCTCCTGAGCACAGCTGCTGG - Intronic
935009614 2:99121177-99121199 ATGCCCAGGAGCACAACTGCTGG + Intronic
936544169 2:113375954-113375976 GTGCCAGGTAGTACAACTGCAGG + Intergenic
936862969 2:117040205-117040227 GTGTTCTGGAGTGCAATTGCTGG - Intergenic
937005474 2:118508715-118508737 GTACTTAGGAGTAGAATTGCTGG - Intergenic
937768648 2:125693407-125693429 ATACTCAAGAGTACAATTGCTGG - Intergenic
937816336 2:126254903-126254925 GTGACCAAGAGCACAACTGCTGG + Intergenic
938825914 2:135005171-135005193 AAGCTCAGGGGTACAAGTGCAGG + Intronic
939901631 2:147857846-147857868 AAGTTCAGGAGTACACCTGCAGG + Intronic
940105604 2:150096261-150096283 GTTGCCAGGAGTAGAACTGCTGG - Intergenic
944029857 2:195222311-195222333 ATGTTCAGGAGTACATGTGCAGG - Intergenic
945128065 2:206535437-206535459 ATGCCTAGGAGTAGAACTGCTGG - Intronic
945389892 2:209252269-209252291 ATACTCAGAAGTAAAACTGCTGG - Intergenic
945608975 2:211974205-211974227 AAGTTCAGGAGTACAAGTGCAGG - Intronic
947116128 2:226772952-226772974 GTTCTCTGGAGTACATATGCTGG - Intronic
947128337 2:226895347-226895369 GTGGTCAGGAGCACAGCTACTGG - Intronic
947424396 2:229970143-229970165 ATGCCCAGGAGTGCAATTGCTGG - Intronic
947582238 2:231327688-231327710 ATGCCCAGGAGTATAATTGCTGG + Intronic
947655375 2:231822236-231822258 TTGCCCAGGAGTGCAGCTGCTGG + Intergenic
947816001 2:233037413-233037435 GTGCTCCAGAGTAGAACTGCTGG - Intergenic
948208698 2:236177193-236177215 ATGCTCAGGAGGGCAGCTGCAGG + Intergenic
948500905 2:238393058-238393080 GTGTCCAGGAGTACAACTGTTGG + Intronic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
948546395 2:238732471-238732493 GTACTTAGGAGCACAATTGCTGG + Intergenic
1168751763 20:287174-287196 ATGCCCAAGAGTAAAACTGCTGG + Intronic
1169182916 20:3586029-3586051 GTACCTAGGAGTAAAACTGCTGG - Intronic
1169670936 20:8101647-8101669 ATGCCCAGGAGTACAATTGCAGG - Intergenic
1169855756 20:10100781-10100803 ATGCTCAGGAGAGCAATTGCTGG - Intergenic
1170710768 20:18788426-18788448 GTGCTAAGGAGCAAAACTTCTGG + Intergenic
1172957376 20:38770774-38770796 AGGCTCAGGAGTCCAGCTGCTGG - Intronic
1174530215 20:51206126-51206148 GAGCACAGGAGTTCAAGTGCAGG - Intergenic
1174618544 20:51855760-51855782 GTGCCCCGGAGCGCAACTGCTGG + Intergenic
1175261588 20:57677656-57677678 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1175679962 20:60978891-60978913 GTGCGGAGGAGTAGAACTGCTGG + Intergenic
1177581152 21:23022811-23022833 AAGCTCAGGGGTACAAGTGCAGG + Intergenic
1178166928 21:29989671-29989693 ATGCCCAGGAGTACAACTTCTGG - Intergenic
1178215106 21:30587584-30587606 ATGCTCGGGGGTACAAATGCAGG + Intergenic
1179102721 21:38368632-38368654 GAGTTCAGGGGTACAAGTGCAGG + Intergenic
1179715829 21:43287718-43287740 ATGCCCAAGAGTACAATTGCTGG + Intergenic
1182085607 22:27559116-27559138 GTGCCCAGGAGTGCAATTGCTGG - Intergenic
1182378254 22:29864650-29864672 ATGCCCAAGAGTACAACTGCTGG + Intergenic
1183657910 22:39200835-39200857 ATGCCCAGGAGTGCAACTGCTGG - Intergenic
1184427343 22:44419134-44419156 GTGCCCAGGAGGGCAATTGCTGG - Intergenic
1184456188 22:44610904-44610926 GTGCCCAGGAATGCAATTGCTGG - Intergenic
1184465406 22:44666369-44666391 GTGCCCAGGAGTGTAATTGCTGG - Intergenic
1185257407 22:49842977-49842999 ATGCCCAGAAGCACAACTGCTGG - Intergenic
949371459 3:3338981-3339003 ATACTCAGGAGTAGAACTGCTGG + Intergenic
950611352 3:14128755-14128777 ATACCTAGGAGTACAACTGCTGG - Intronic
951750865 3:26034899-26034921 AAGTTCAGGAGTACAAGTGCAGG - Intergenic
952643040 3:35621072-35621094 AAGTTCAGGAGTACATCTGCAGG - Intergenic
952915396 3:38234719-38234741 GTGCCTAGGAGTAGAACTGCTGG - Intronic
953307696 3:41844842-41844864 ATGCTCAGGAGTGCAATTGCTGG - Intronic
953903322 3:46855513-46855535 ATGCCCAGAAGTACAATTGCTGG + Intergenic
954226335 3:49183705-49183727 ATGCCCAGGAATACAATTGCTGG - Intronic
955030110 3:55208086-55208108 AAGCCCAGGAGTACAATTGCTGG + Intergenic
956302143 3:67783610-67783632 GTCTCCAGGAGTGCAACTGCTGG + Intergenic
957536208 3:81507042-81507064 AAGTTCAGGAGTACAAGTGCAGG - Intronic
957984788 3:87560279-87560301 AAGCTCAGGAGTACATGTGCAGG + Intergenic
958615390 3:96487646-96487668 TGGCTCAGGGGTACAAGTGCAGG + Intergenic
959315073 3:104793830-104793852 GCCCTCAAGATTACAACTGCTGG + Intergenic
959371260 3:105528854-105528876 AAGCTCAGGGGTACAAATGCAGG - Intronic
960432404 3:117585082-117585104 AAGTTCAGGAGTACAAGTGCAGG - Intergenic
960751199 3:120956149-120956171 ATGCCCAGGAGTACAACTGAAGG + Intronic
962722803 3:138192005-138192027 ATGCCCAGGAGTGCAATTGCAGG + Intronic
963227303 3:142875447-142875469 GTAGTCAGGAGTGGAACTGCTGG - Intronic
963385534 3:144588099-144588121 GTGCCCAGGAATGCAATTGCTGG + Intergenic
964870151 3:161304990-161305012 ATGCTCAAGAGTGCAATTGCTGG - Intergenic
965696900 3:171418335-171418357 TTTCTCAGGAGTAGAATTGCTGG - Intronic
965718617 3:171635279-171635301 ATGTTAAGGAGTAGAACTGCTGG + Intronic
965787739 3:172353553-172353575 GAGCTCAGGGGTTCAACTGAGGG + Intronic
966022351 3:175230658-175230680 TAGCTCAGAAGTACAACTGCCGG - Intronic
966701378 3:182856011-182856033 ATGCCCAAGAGTGCAACTGCTGG - Intronic
967374588 3:188786557-188786579 ATGCCCAGGAGTGCAACTGCTGG - Intronic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968248196 3:197176814-197176836 ATACCAAGGAGTACAACTGCTGG + Intronic
968400190 4:287801-287823 GTGCTCAGAAGTAGAATTACTGG + Intronic
971411417 4:26376640-26376662 ATGCTCAGGAGTGGAACTGATGG + Intronic
972703000 4:41512382-41512404 GTACTTAGGAGTATAACAGCTGG - Intronic
973253812 4:48088290-48088312 GTGCTTAAGTGTACACCTGCTGG - Intronic
974446470 4:61990020-61990042 ATGCTTAGGAGTAGAATTGCTGG - Intronic
975463043 4:74676913-74676935 ATGCTCAGGAGCACAATTGCTGG + Intergenic
975868928 4:78756705-78756727 GTGCTCAGGGTTACAATTGCTGG + Intergenic
976443508 4:85104169-85104191 AAGTTCAGGGGTACAACTGCAGG - Intergenic
976449874 4:85176168-85176190 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
977367256 4:96085999-96086021 GTGCCCAGAAGTACAATTGTTGG - Intergenic
978406898 4:108389848-108389870 ATGCCCAGAAGTACAATTGCTGG - Intergenic
980008506 4:127568633-127568655 ATGCCCAAGAGTACAATTGCTGG - Intergenic
980766610 4:137314509-137314531 ATTCTCAAGAGTACAATTGCTGG + Intergenic
981381465 4:144076820-144076842 ATGCCCAGTAGTAGAACTGCTGG + Intergenic
981690744 4:147505989-147506011 ATGCTCAAGAGTGCAACTGCTGG - Intronic
982763312 4:159315323-159315345 ATGTTCAGGAGTACAAGTGCAGG + Intronic
982768070 4:159370194-159370216 ATGCCCAAGAGTTCAACTGCTGG - Intergenic
983466865 4:168105132-168105154 GAGTTCAGGAGTACATGTGCAGG + Intronic
983564905 4:169139652-169139674 ATGTCCAGGAGTAGAACTGCTGG + Intronic
983621234 4:169763210-169763232 ATACTCAGGAGTGCAATTGCTGG + Intergenic
984445843 4:179834418-179834440 GTGCTCAGGGGAAGGACTGCAGG - Intergenic
985180308 4:187253467-187253489 AAGTTCAGGAGTACAAGTGCAGG - Intergenic
985483700 5:136837-136859 GTGCCCAGAAGTGGAACTGCTGG - Intergenic
985702028 5:1379227-1379249 CTGCTCAGGAGTTGAAGTGCAGG + Intergenic
986028521 5:3873270-3873292 ATGCTAAGGAGCACAGCTGCTGG - Intergenic
987784117 5:22477102-22477124 AAGTTCAGGAGTACAAGTGCAGG + Intronic
987800206 5:22685904-22685926 ATGCTTAGGAGTAGAATTGCTGG + Intronic
988027756 5:25721509-25721531 GTGTTCAGAAGTGCAATTGCTGG - Intergenic
988844371 5:35113724-35113746 GTGCTAAGGAGGACCCCTGCAGG + Intronic
989680723 5:44026845-44026867 AAGCTCAGGGGTACAAGTGCAGG + Intergenic
993014429 5:82519646-82519668 GTCCTCAGGAGGACAAGTCCAGG - Intergenic
993099785 5:83523502-83523524 GTGCTCAGGAGTGCACCTATTGG + Intronic
994630629 5:102281885-102281907 ATGCCCAGGAGTAAAACTGCTGG - Intronic
995257753 5:110066643-110066665 AAGTTCAGGAGTACATCTGCTGG + Intergenic
995398002 5:111708967-111708989 ATCACCAGGAGTACAACTGCTGG + Intronic
996864350 5:128103101-128103123 ATGCTGAGGAGTAGAATTGCTGG + Intronic
998447380 5:142208841-142208863 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
998997882 5:147885812-147885834 ATGCCCAAGAGTACAATTGCTGG - Intronic
1001441527 5:171747479-171747501 GAGCTCTGGAGTTCAAATGCTGG - Intergenic
1002014626 5:176310292-176310314 ATGTCCAGGAGCACAACTGCTGG - Intronic
1002378983 5:178811487-178811509 CTGCTGAGGAATAGAACTGCAGG - Intergenic
1003252661 6:4444656-4444678 ATGCCCAGGAGTACAATTCCTGG + Intergenic
1004431120 6:15544419-15544441 ATGCCCAAGAGTGCAACTGCTGG + Intronic
1004939727 6:20543179-20543201 TTGCCCAGGAGTACAATTGCTGG + Intronic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1006252723 6:32802851-32802873 ATGCTCAGGAGTGCAATTGCTGG + Intergenic
1006283011 6:33070722-33070744 ATGTTCAGGAGTACATGTGCAGG + Intronic
1006546945 6:34788130-34788152 GTGCCCAGGAGTGCAATAGCTGG - Intergenic
1006675989 6:35764038-35764060 ATGCTCAGCAGTGAAACTGCTGG - Intergenic
1007504933 6:42328362-42328384 AGGCTCAGGAGTACCTCTGCAGG + Intronic
1008454362 6:51691781-51691803 AAGCTCAGGGGTACAAGTGCAGG - Intronic
1009042295 6:58193590-58193612 GAGCTCAGGGGTACAAGTGCAGG + Intergenic
1009218134 6:60947810-60947832 AAGCTCAGGGGTACAAGTGCAGG + Intergenic
1009509136 6:64525848-64525870 ATGCCCAGGAGTACAATTTCTGG - Intronic
1010467071 6:76180606-76180628 GAGTTCAGGGGTACAAGTGCAGG + Intergenic
1013848532 6:114484903-114484925 GGGTTCAGGAGTACATGTGCAGG - Intergenic
1014233152 6:118926789-118926811 CAGCTAAGGAGTAGAACTGCTGG + Intronic
1015294716 6:131577379-131577401 GCACCCAGGAGTAGAACTGCTGG - Intronic
1016235930 6:141866271-141866293 ATACCCAGGAGTACAATTGCTGG - Intergenic
1016427287 6:143948236-143948258 GTGGTCTGGAGTTCAGCTGCAGG - Exonic
1016638957 6:146326565-146326587 AAGTTCAGGAGTACAAGTGCAGG - Intronic
1017235074 6:152110652-152110674 GGGTTCAGGAGTACATGTGCAGG - Intronic
1018075010 6:160204488-160204510 ACGCTCAGGAGTGCAACTGGTGG + Intronic
1018255306 6:161912513-161912535 GTGTCCAGGAGTGCAAATGCAGG - Intronic
1018502807 6:164430184-164430206 GTGGTCAGAAATACAACTGTAGG + Intergenic
1021364215 7:19756386-19756408 GTGTGTAGGAGTACATCTGCAGG + Intronic
1021433943 7:20593020-20593042 GAGTTCAGGGGTACAAGTGCAGG - Intergenic
1021818158 7:24468432-24468454 ATGCACAGGAGTACAATTGATGG + Intergenic
1023712032 7:43005283-43005305 GTACTCAGAAGTAGAATTGCTGG + Intergenic
1024027128 7:45421191-45421213 TTGCCCAGGAGTGCAACTGTTGG + Intergenic
1026791887 7:73338492-73338514 GTGCCTAGGAGTGCAATTGCTGG + Intronic
1027921166 7:84397571-84397593 AAGCTCAGAAGTACAAGTGCAGG + Intronic
1028014921 7:85696784-85696806 GTGGTTAGGAGTACAGATGCTGG - Intergenic
1028322028 7:89472092-89472114 TTGCTCAAGAGTACAATTGCTGG - Intergenic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1028970452 7:96852791-96852813 ATACTCAGGAATACAAATGCTGG - Intergenic
1029066778 7:97857695-97857717 GAGCTCAGGAGTTCAAGTCCAGG - Intronic
1029137854 7:98387340-98387362 GTGCTCAAGAAAACAGCTGCGGG + Intronic
1029212063 7:98917308-98917330 GTGCACATCAGCACAACTGCAGG - Intronic
1029418675 7:100460238-100460260 ATGCCCAAGAGTACAACTGTTGG + Intronic
1029943845 7:104511025-104511047 AAGTTCAGGAGTACAAGTGCAGG - Intronic
1031106282 7:117546533-117546555 GTTCTCAGTGGTACAACTACAGG + Intronic
1031469494 7:122152130-122152152 AAGTTCAGGGGTACAACTGCAGG + Intergenic
1032272733 7:130425631-130425653 GTGCTCAGGAGTACAACTGCTGG - Intronic
1032273691 7:130435717-130435739 ACGCCCAGGAGTACAATTGCTGG - Intronic
1032579666 7:133092461-133092483 GTACCCAGGAGTAGAATTGCTGG - Intergenic
1032991955 7:137403546-137403568 GGGCTCAGGAGTAAGGCTGCAGG + Intronic
1033709277 7:143923923-143923945 ATGCTCAGGGATACAACTGCTGG - Intergenic
1033792295 7:144805266-144805288 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1034669291 7:152845826-152845848 ATGCTCAGGAAGACAGCTGCAGG - Intronic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035563245 8:624394-624416 GTGCCTAGGAGTAGAACTGCAGG - Intronic
1036524880 8:9525765-9525787 ATACTGAGGAGTAAAACTGCTGG - Intergenic
1036580563 8:10071010-10071032 GTGCCCAGGAGTGCAATTGCTGG + Intronic
1036760880 8:11507846-11507868 GTGCTCACGTGTAGAAATGCTGG - Intronic
1036941112 8:13053411-13053433 ATGACCAGAAGTACAACTGCTGG + Intergenic
1037058823 8:14480874-14480896 AAGTTCAGGAGTACAAGTGCAGG - Intronic
1039199467 8:35073161-35073183 GAGCTCAGGAGTTCAACACCAGG + Intergenic
1040787157 8:51179198-51179220 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1041020629 8:53634711-53634733 CTGCCCAGGAGTACAATTGCTGG + Intergenic
1041353886 8:56979017-56979039 AAGTTCAGGAGTACAAGTGCAGG - Intronic
1041768178 8:61442451-61442473 ATGCGCAGGAGTACAATTGCTGG + Intronic
1042360664 8:67879035-67879057 ATACTGAGGAGTACAGCTGCTGG - Intergenic
1042629044 8:70796081-70796103 ATGTTCAGGAGTACATGTGCAGG + Intergenic
1042771460 8:72387003-72387025 ATACCCAGGAGTAGAACTGCTGG + Intergenic
1043046901 8:75337353-75337375 ATTCTAAGGAGTACAATTGCTGG + Intergenic
1045283363 8:100769029-100769051 ATGCCCAGTAGTAGAACTGCTGG - Intergenic
1045855534 8:106761259-106761281 GTGCTGAGGAGCACATCTACAGG - Exonic
1046155816 8:110288976-110288998 TTACTCAGGAGTACAATTGCTGG - Intergenic
1047033473 8:120909912-120909934 ATGTTCAAGAGTACATCTGCAGG - Intergenic
1047395945 8:124499052-124499074 GAGCTCAGGAGTTCAAGTGATGG - Intronic
1048810624 8:138282811-138282833 ATGCCAAGGAGTGCAACTGCTGG - Intronic
1050127502 9:2374177-2374199 AGGTTCAGGAGTACAAGTGCGGG - Intergenic
1051234810 9:14988290-14988312 ATACTCAGGAGTGCAATTGCTGG - Intergenic
1051683568 9:19633309-19633331 ATGCCCAAGAGTACAATTGCTGG + Intronic
1052401760 9:28009850-28009872 GTACCCAGGAGTAGAAGTGCTGG - Intronic
1052735491 9:32338172-32338194 AGGCTCAGGAGTACATGTGCAGG - Intergenic
1053457874 9:38245081-38245103 GTCCTCAGAGGTCCAACTGCCGG - Intergenic
1054701811 9:68420322-68420344 GTGATCTTGAGTACAACTGAAGG + Intronic
1054796121 9:69303713-69303735 GTGCTCAAGAGTGCAGTTGCTGG + Intergenic
1055578359 9:77682433-77682455 ATGCTCAGGAGTGCAATTTCTGG + Intergenic
1056100123 9:83293099-83293121 GTGCTCACCAGAACAGCTGCAGG - Intronic
1057310185 9:93938068-93938090 GTGCCCAGGGGTGGAACTGCTGG - Intergenic
1058641779 9:107094572-107094594 ATGCCAAGGAGTACAATTGCTGG - Intergenic
1059297977 9:113289333-113289355 GTGGACATGAGTACAATTGCTGG + Intronic
1060387434 9:123244783-123244805 ATGCCCAAGAGTACAATTGCTGG - Intronic
1060594071 9:124838018-124838040 GGGCTCAGGAGCAAAGCTGCAGG + Intergenic
1062673676 9:137726632-137726654 GTGCCCAGCAGTGGAACTGCTGG + Intronic
1062675133 9:137738521-137738543 GTGCCCAGCAGTGGAACTGCTGG - Intronic
1186560582 X:10608234-10608256 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1186801282 X:13094609-13094631 GTACTTAGGAGTAAAATTGCTGG + Intergenic
1187186306 X:16989914-16989936 ATGCCCAGGAGTGCAATTGCTGG - Intronic
1187352916 X:18537950-18537972 GTGCTCAAGAGTGCAGTTGCTGG + Intronic
1187362236 X:18639626-18639648 ATACTTAGGAGTAAAACTGCTGG - Intronic
1187545640 X:20249324-20249346 ATGTCCAGGAGTACAACTGCTGG + Intronic
1187750574 X:22459764-22459786 GTACTTAGGAGTAGAACTTCTGG - Intergenic
1187925461 X:24245640-24245662 GTACCCAGGAGTAAAACTGATGG + Intergenic
1189475893 X:41355304-41355326 ATGCCCAGGAGTACAATTGCTGG + Intronic
1189823176 X:44890405-44890427 GTGCCCAAGAGTACAATTGCTGG + Intronic
1190024350 X:46910055-46910077 ATGCTCAGGAGTGCAATTGCTGG - Intergenic
1190073017 X:47294248-47294270 ATGCTCAGGGGTACAAGTGCAGG + Intergenic
1193449841 X:81652166-81652188 ATGTTCAGGAGTACAAGTGCAGG - Intergenic
1194382266 X:93208936-93208958 GTACTCAGCAGTGGAACTGCTGG - Intergenic
1194776666 X:97973513-97973535 ATGCTCAGGAGTACAATTGCTGG + Intergenic
1195652014 X:107294771-107294793 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1195901549 X:109802998-109803020 CTGCCCAGGAGTAAAATTGCTGG - Intergenic
1196008391 X:110859607-110859629 ATGCTTAGGAGTAGAAGTGCTGG - Intergenic
1196134747 X:112196496-112196518 ATGCCCAGGAGTGCAATTGCTGG + Intergenic
1196353137 X:114756327-114756349 AAGCCCAGGAGTGCAACTGCTGG - Intronic
1197857402 X:130930771-130930793 AAGCTCAGGAGTATGACTGCTGG - Intergenic
1198295771 X:135284837-135284859 ATTCTCATGAGTATAACTGCTGG + Intronic
1198324882 X:135559650-135559672 ATGCCCAGGAGTGCAATTGCTGG + Intronic
1198716083 X:139558935-139558957 GTGCTTAGGAGCACAAATTCTGG + Intronic
1199029917 X:142985498-142985520 AAGTTCAGGAGTACAAGTGCAGG + Intergenic
1199247001 X:145617164-145617186 ATGCCCAGGAGTGCAATTGCTGG - Intergenic
1199352938 X:146825380-146825402 GTGCTCAAGAGCAAAACTGCTGG - Intergenic
1199667938 X:150116669-150116691 ATGCTCCGGGGTAGAACTGCAGG + Intergenic
1200254740 X:154574260-154574282 GAGCTCAGGTGTACATGTGCAGG - Intergenic
1200263029 X:154630148-154630170 GAGCTCAGGTGTACATGTGCAGG + Intergenic
1200314927 X:155122488-155122510 ATGTCCAGGAGCACAACTGCTGG - Exonic
1200394399 X:155975040-155975062 ATGGTCAGGATTACAACTGGGGG - Intergenic
1201304753 Y:12541251-12541273 GTGGTCAGGAGTGCTACTGCTGG - Intergenic