ID: 1032274375

View in Genome Browser
Species Human (GRCh38)
Location 7:130441230-130441252
Sequence CTCTCTTCCCGCCCTAAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 140}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032274375_1032274396 26 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274396 7:130441279-130441301 CTGCGCAAAGCCGGGGGCGGGGG 0: 1
1: 0
2: 0
3: 36
4: 336
1032274375_1032274385 -8 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274385 7:130441245-130441267 GAAGAGAGGCGCGGGGGGAGGGG 0: 1
1: 1
2: 3
3: 71
4: 1084
1032274375_1032274384 -9 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274384 7:130441244-130441266 GGAAGAGAGGCGCGGGGGGAGGG 0: 1
1: 0
2: 1
3: 83
4: 1368
1032274375_1032274383 -10 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274383 7:130441243-130441265 GGGAAGAGAGGCGCGGGGGGAGG 0: 1
1: 0
2: 3
3: 143
4: 1856
1032274375_1032274395 25 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274395 7:130441278-130441300 CCTGCGCAAAGCCGGGGGCGGGG 0: 1
1: 0
2: 0
3: 16
4: 150
1032274375_1032274391 20 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274391 7:130441273-130441295 TGGCGCCTGCGCAAAGCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1032274375_1032274393 24 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274393 7:130441277-130441299 GCCTGCGCAAAGCCGGGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 187
1032274375_1032274389 18 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274389 7:130441271-130441293 GCTGGCGCCTGCGCAAAGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 159
1032274375_1032274390 19 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274390 7:130441272-130441294 CTGGCGCCTGCGCAAAGCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 82
1032274375_1032274386 -4 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274386 7:130441249-130441271 AGAGGCGCGGGGGGAGGGGAAGG 0: 1
1: 0
2: 17
3: 317
4: 2626
1032274375_1032274388 17 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274388 7:130441270-130441292 GGCTGGCGCCTGCGCAAAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 120
1032274375_1032274392 23 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274392 7:130441276-130441298 CGCCTGCGCAAAGCCGGGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
1032274375_1032274387 0 Left 1032274375 7:130441230-130441252 CCAGCCTTAGGGCGGGAAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 140
Right 1032274387 7:130441253-130441275 GCGCGGGGGGAGGGGAAGGCTGG 0: 1
1: 0
2: 9
3: 175
4: 1539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032274375 Original CRISPR CTCTCTTCCCGCCCTAAGGC TGG (reversed) Exonic
900256053 1:1698831-1698853 CCGTCTTCCAGCCCTAACGCTGG + Intronic
900264721 1:1751441-1751463 CCGTCTTCCAGCCCTAACGCTGG + Exonic
900924882 1:5698573-5698595 CACTCTTTGCTCCCTAAGGCTGG + Intergenic
902799557 1:18820836-18820858 GTCTCTTCCAGGCCCAAGGCTGG - Intergenic
903366899 1:22810808-22810830 CTGTCATCCCACCCCAAGGCCGG + Intronic
903383237 1:22910721-22910743 CTCTCCTGCACCCCTAAGGCAGG - Intronic
903550072 1:24151807-24151829 CCCTCTTTCCGCCGAAAGGCAGG - Intergenic
905583242 1:39098076-39098098 CTCTCTTCCTGCTCTGAGGCAGG - Intronic
905775426 1:40664890-40664912 CCCTCTTCCCACCCCAGGGCTGG + Intronic
905856294 1:41316938-41316960 CTCTCTTCCAGCCTTGGGGCTGG + Intergenic
907435053 1:54440272-54440294 GTTCCTTCCTGCCCTAAGGCAGG - Intergenic
908908105 1:69038971-69038993 CTCTCTTTCTGTCCTAAAGCTGG - Intergenic
912519889 1:110238072-110238094 CTCTCCTCACCCCCTAAAGCTGG - Intronic
914509480 1:148318358-148318380 CTCTCTTGCCACTCTTAGGCAGG + Intergenic
914938430 1:152001009-152001031 TTCTCTTCCTCCTCTAAGGCTGG - Intergenic
915147211 1:153802288-153802310 CTCTCTTCCCGGCTCATGGCAGG - Intergenic
915327405 1:155087382-155087404 CTCCCTTCCAGCCCTGAGCCGGG + Exonic
918203440 1:182288506-182288528 TACTCTTCCCATCCTAAGGCTGG - Intergenic
1065792499 10:29274361-29274383 CTTTTTTCCCTCCCTTAGGCTGG - Intergenic
1066759860 10:38740302-38740324 CTCTCGTCCAGCCCTTATGCAGG + Intergenic
1067029132 10:42868627-42868649 CTTTCCTCCTGCCCTGAGGCTGG + Intergenic
1067081857 10:43216689-43216711 CCCTCTACCCTCCCCAAGGCGGG - Intronic
1077413898 11:2415627-2415649 CTCTGTGCCCGCCCCAATGCAGG - Intronic
1080683446 11:34496400-34496422 CTCTCCTCCCGTCCTGAGGATGG - Intronic
1081716195 11:45252288-45252310 CTCCCTTCCAGCCCCAAGCCAGG + Intronic
1083305195 11:61758335-61758357 CTCTCTTCTCCCTCTATGGCTGG + Intronic
1084213522 11:67634679-67634701 CTGTCGTCCTGCCCTTAGGCTGG + Intronic
1084413941 11:69019653-69019675 CTCTCTTGCTGCCCCAAAGCAGG - Intergenic
1084899261 11:72297495-72297517 CCCTTTTCCTGCCCCAAGGCAGG - Intronic
1089168141 11:116493461-116493483 ATTTCTTCCCCCTCTAAGGCAGG - Intergenic
1091965484 12:4737465-4737487 CTCTCCTCCCTCCCAGAGGCAGG - Intronic
1092979389 12:13778457-13778479 CCCTGTCCCCTCCCTAAGGCTGG - Intronic
1096461976 12:51826779-51826801 CCCTCTTCCCGCCCTTAGGTTGG - Intergenic
1096526586 12:52213548-52213570 CTCTCTTCCCTCCTTGAGGCTGG + Intergenic
1097257825 12:57694113-57694135 ATCTGTTTCCGCCCTAAGCCAGG - Exonic
1100518190 12:95348368-95348390 CTCTCTTCCCGGCTTATGGATGG - Intergenic
1103835444 12:123816330-123816352 CCCTCTTCCCTCCCCAAGGGTGG - Intronic
1104724131 12:131065785-131065807 CTCTCTTCCCCACATAAGGTAGG + Intronic
1107508901 13:41061752-41061774 CTCTCCTCCCGCCCTTCGGCCGG + Intronic
1108101342 13:46959759-46959781 TTGTTTTCCCACCCTAAGGCAGG - Intergenic
1109369439 13:61402559-61402581 CTCTCTTATCTCCTTAAGGCTGG + Intergenic
1111931813 13:94520444-94520466 CTGTCTTCCAGCCTTATGGCAGG - Intergenic
1113040568 13:106100372-106100394 CTCTGTCCCCACCCTAGGGCAGG + Intergenic
1113957451 13:114106972-114106994 CTCTTTTCCCTCCCTCAGCCAGG + Intronic
1114744441 14:25132714-25132736 CTCTCTTCCCTCCCTCAGAATGG - Intergenic
1115700974 14:35952751-35952773 GTCTCTTCCTTCTCTAAGGCAGG - Intergenic
1117789958 14:59330024-59330046 CTCCCTTCCAGCCCTTCGGCTGG + Intronic
1119050575 14:71364391-71364413 TTCTCTTCCCACCCTTAGTCTGG + Intronic
1119261130 14:73238332-73238354 CTCTCCTGCCGCCCGAGGGCAGG - Intronic
1121357926 14:93230921-93230943 CTCACTGCCCGCTCTCAGGCCGG - Intergenic
1123443275 15:20304913-20304935 CTCTCGTCCTGCCCTTATGCAGG + Intergenic
1124991789 15:34681635-34681657 CCCTTTTCTGGCCCTAAGGCTGG + Intergenic
1125746959 15:42003834-42003856 CACTCTGCCCGGCCTGAGGCGGG + Intronic
1126475631 15:49062819-49062841 CTCTGTTCTTGCCATAAGGCAGG - Intergenic
1127029433 15:54845470-54845492 CTCTTTTCTCTCCCCAAGGCGGG - Intergenic
1127962732 15:63901848-63901870 CTCTTTTTCCTCCCTAGGGCAGG + Intergenic
1128761975 15:70223274-70223296 TTCTGCTCCCACCCTAAGGCAGG + Intergenic
1135838913 16:25855881-25855903 CTTTCTTCCCTCCCTTAGGTGGG + Intronic
1136147658 16:28324890-28324912 CTCCCTCCCTGGCCTAAGGCAGG + Intergenic
1141563138 16:84883564-84883586 ATCTGTTCCAGCCCTCAGGCAGG - Intronic
1143174266 17:4947646-4947668 CTCCCTTCCCGCCATCCGGCGGG - Intronic
1143648084 17:8245142-8245164 CTCTCTTCCCACCCTCAAGTAGG - Intronic
1143887486 17:10076070-10076092 CCCTCTTCCCTTCCCAAGGCTGG - Intronic
1144580263 17:16454960-16454982 CTCTGTCCCCGCCCTCAGGCTGG + Intronic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1148715111 17:49710557-49710579 CTCTCCGCCCGCCCCAGGGCTGG - Exonic
1148891571 17:50811326-50811348 TTCTCTTCCTGCCATAAGTCAGG - Intergenic
1148989009 17:51649110-51649132 CTGGCTTCCCGCCTTCAGGCAGG + Intronic
1151546549 17:74796793-74796815 ACCTTTTCCCGCCCCAAGGCTGG - Intronic
1151719678 17:75847965-75847987 CCCTCTCCCCGCCCCAAGGCAGG - Intronic
1151913993 17:77104026-77104048 CTCTCTTCCCACCGTAAAGTAGG + Intronic
1152401607 17:80069941-80069963 CTGTCCTCCCTCCCTAGGGCAGG - Intronic
1156377788 18:36530385-36530407 CTCTCTACCCCCACTAGGGCAGG + Intronic
1157587980 18:48817363-48817385 GTCTCTTACCTCCCTGAGGCAGG - Exonic
1158339734 18:56452592-56452614 CTCTCTTCCTTTCCCAAGGCTGG - Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162046280 19:8002477-8002499 CTCACTTCCCTCCCACAGGCTGG + Intronic
1162374965 19:10299605-10299627 CTCTCTTCACACCCTTGGGCAGG + Intergenic
1162430079 19:10623157-10623179 GTCTCTGCCAGCCCAAAGGCTGG - Intronic
1163485076 19:17580651-17580673 CTCTCCTCCCGCCCTCCGGAGGG - Intronic
1164390453 19:27815166-27815188 CTCACCTCCAGCCCTAAGGCTGG - Intergenic
1167816655 19:51888105-51888127 CTCTTTTCGCGCCTTAAGACAGG + Intronic
1168605604 19:57757532-57757554 CTCTCATCACGCCCTAAGGGGGG - Exonic
927050146 2:19320104-19320126 CTCACTTCTCAGCCTAAGGCAGG + Intergenic
929134080 2:38606182-38606204 CTCTGTGCCCAGCCTAAGGCAGG - Intergenic
929716292 2:44314268-44314290 CTCTCTTCCCCTCAAAAGGCAGG + Intronic
931258928 2:60599824-60599846 TTCGCTGCCCTCCCTAAGGCAGG - Intergenic
932382576 2:71298847-71298869 CCCTCCTCCCTCCCTAAGGAGGG + Intronic
935184417 2:100718584-100718606 CTCCTTTCCCTCCCCAAGGCAGG - Intergenic
936857789 2:116980806-116980828 CTCTCCTCCCTCCCTAAGGATGG - Intergenic
937221462 2:120345132-120345154 CTCTCTCCCGGCCCTGCGGCGGG + Intergenic
937310033 2:120896377-120896399 CTGTCTTCCCTGCCTGAGGCAGG + Intronic
943137672 2:183935797-183935819 CTCTCTTCCTGCCCAAAGTCTGG + Intergenic
944038155 2:195322617-195322639 CTCTCAACCCTCCCTAAGGCTGG + Intergenic
944431025 2:199633788-199633810 CTCTCTGCCAGCCCTGGGGCTGG + Intergenic
947625693 2:231616829-231616851 CTCTCCTGCTGCCCCAAGGCCGG - Intergenic
1172945051 20:38680836-38680858 CTCTATTCCCACTATAAGGCTGG - Intergenic
1173785909 20:45792534-45792556 CTATCGTCCCACCCCAAGGCGGG + Intronic
1175108111 20:56628731-56628753 CTCTCCTCCCGCCCGGGGGCCGG + Intergenic
1178525428 21:33324719-33324741 CACTCTTTCCGGCCTATGGCCGG - Intronic
1178578336 21:33814993-33815015 CTCCCTTCCCGCTTTAAGGTGGG - Intronic
1179770483 21:43611760-43611782 CCCTCATCCCGCCCTGCGGCAGG - Intronic
1183232731 22:36593059-36593081 CTCTCCTCGCTCCCCAAGGCTGG - Intronic
1183475867 22:38035455-38035477 CTCTCTTCCCTTCCCAGGGCAGG + Intronic
1184124815 22:42479644-42479666 CCCTCATTCCGCCCTGAGGCTGG + Intergenic
1185138991 22:49089715-49089737 CTCTCTTCCCGCCCTCCAGACGG - Intergenic
952644448 3:35639186-35639208 TTCTCCGCCAGCCCTAAGGCTGG - Intronic
953253311 3:41265721-41265743 CACCCTTCCCTCCCTAAGGCAGG + Intronic
954440168 3:50517415-50517437 CTCCCTTCCCTCTCTGAGGCAGG + Intergenic
961615141 3:128173313-128173335 CCATCTTCACTCCCTAAGGCAGG + Intronic
962108267 3:132416216-132416238 GTCTTTTTCCGCCCTAAGGTAGG + Intergenic
967884351 3:194322952-194322974 CTCTCTCCCCTCCCTGAGGCTGG - Intergenic
968293200 3:197554958-197554980 CTCTCTCCCCGCCCTCCGGCCGG - Intronic
968978230 4:3833010-3833032 CTCTCTCCCCACCCACAGGCTGG - Intergenic
969255189 4:5996529-5996551 CTCTCTTCCCACCCTCTGCCTGG + Intergenic
969660079 4:8522256-8522278 CTCCCTCCCCGCCGAAAGGCAGG - Intergenic
970517286 4:16845449-16845471 CTCTCTTGCCTTCCTACGGCAGG + Intronic
985016347 4:185639120-185639142 CTCCCCTCCCGGCCTAACGCAGG - Intronic
989096708 5:37788554-37788576 CTCTGTTCCCAGCCTTAGGCAGG + Intergenic
990333238 5:54747688-54747710 CTCTCTTCCTGCCCTCTGCCAGG + Intergenic
991674293 5:69076025-69076047 CTCTCTTCCAGCCCTGAGGCTGG - Intergenic
992994116 5:82315810-82315832 CTCTATTCCCACCATAAGCCAGG - Intronic
997979222 5:138458731-138458753 CTCTCTCCCAGGCCTGAGGCTGG - Intergenic
1006456314 6:34133855-34133877 CTCTCTTCCCCTTCTAAGGTTGG - Exonic
1006630567 6:35427288-35427310 CTCCCTTCCCTCCCTGAGGCAGG + Exonic
1010260064 6:73805395-73805417 CCCACCTCCAGCCCTAAGGCAGG + Intronic
1010465892 6:76166372-76166394 CTCTCTTACTGCCCTCGGGCTGG + Intergenic
1012174098 6:96057595-96057617 CTCTCTCCACTCCCTAAAGCTGG + Intronic
1012252228 6:96991957-96991979 CGCTCTTGCTGCCCTCAGGCTGG - Intronic
1014607303 6:123492952-123492974 CTCTCTGTCTTCCCTAAGGCAGG + Intronic
1021877466 7:25062196-25062218 CTCTCTTCTCACCCTAGAGCCGG - Intergenic
1022194386 7:28049968-28049990 TCCTCTCCCCTCCCTAAGGCTGG + Intronic
1022445994 7:30471299-30471321 CTCTCTTCCCTCACTAAGTGAGG + Intronic
1027244160 7:76354766-76354788 CTCGTTTTCAGCCCTAAGGCTGG - Intronic
1028496092 7:91463070-91463092 GTCTCTTCCCACCTAAAGGCGGG - Intergenic
1032274375 7:130441230-130441252 CTCTCTTCCCGCCCTAAGGCTGG - Exonic
1032528771 7:132602700-132602722 CTCTCTTCCCTCGCTAAGATGGG - Intronic
1032874291 7:136020712-136020734 CTCTCTTCCTGCCCTACAGATGG - Intergenic
1036507233 8:9366788-9366810 CTCTCTTCTCTCCCTAACGGTGG + Intergenic
1037831310 8:22191338-22191360 GTCTCATCCCTCCCTAAGCCTGG + Intronic
1038743860 8:30238827-30238849 CTCTCTTCCAGCACCCAGGCCGG + Intergenic
1038861795 8:31396059-31396081 CTGTGTTCCCACCCTAAGCCTGG + Intergenic
1039997483 8:42546458-42546480 CTCTCTTACAGCCCCATGGCTGG + Exonic
1041110442 8:54477970-54477992 CTCCCCTCCCTCTCTAAGGCAGG + Intergenic
1041744571 8:61193363-61193385 CCCTCTCCCCGCCCTACGACAGG - Intronic
1045977434 8:108145854-108145876 CTCTCTTCTTGCCATAATGCTGG - Intergenic
1049220541 8:141426889-141426911 CTCTCTACCCTCCCTCAGCCGGG + Intronic
1049605492 8:143527280-143527302 CTCTCTTCCCAGCCCAGGGCTGG - Intronic
1058107415 9:100988542-100988564 CTCTCTTTACTCTCTAAGGCTGG - Intergenic
1059217020 9:112573783-112573805 CTTTCTTTCCCCCCTTAGGCAGG + Intronic
1061909649 9:133715953-133715975 CTCTCTCCCAGCCCTGAAGCGGG + Intronic
1062218919 9:135403922-135403944 CTCTCCTCCTGCCCTGAGGGAGG + Intergenic
1062435004 9:136543132-136543154 CCCTCTTCCCGGCCTCAGGCTGG - Intronic
1192261302 X:69507079-69507101 TTCTCTTTCCTCCCAAAGGCAGG - Intronic
1192756851 X:74055657-74055679 CTCTCTTGCTGTACTAAGGCAGG - Intergenic
1198962842 X:142201115-142201137 CTCTCTTCCCAGCCTGAGGAAGG - Intergenic
1200257163 X:154589219-154589241 CTCGCCTCCCGCCATAGGGCGGG - Intergenic