ID: 1032276354

View in Genome Browser
Species Human (GRCh38)
Location 7:130459546-130459568
Sequence AGCCCGGCAGCCACCAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032276354_1032276358 1 Left 1032276354 7:130459546-130459568 CCCTCTCTGGTGGCTGCCGGGCT No data
Right 1032276358 7:130459570-130459592 CTGCTTTTTACTGCAATTGTGGG No data
1032276354_1032276359 17 Left 1032276354 7:130459546-130459568 CCCTCTCTGGTGGCTGCCGGGCT No data
Right 1032276359 7:130459586-130459608 TTGTGGGCTCTTTGTTTTCAAGG No data
1032276354_1032276357 0 Left 1032276354 7:130459546-130459568 CCCTCTCTGGTGGCTGCCGGGCT No data
Right 1032276357 7:130459569-130459591 GCTGCTTTTTACTGCAATTGTGG No data
1032276354_1032276360 26 Left 1032276354 7:130459546-130459568 CCCTCTCTGGTGGCTGCCGGGCT No data
Right 1032276360 7:130459595-130459617 CTTTGTTTTCAAGGCTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032276354 Original CRISPR AGCCCGGCAGCCACCAGAGA GGG (reversed) Intergenic
No off target data available for this crispr