ID: 1032279042

View in Genome Browser
Species Human (GRCh38)
Location 7:130486438-130486460
Sequence CTCGCAGCCCGCTCCAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032279029_1032279042 29 Left 1032279029 7:130486386-130486408 CCTGAATCAGGTAAGAGGCGGGC 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 129
1032279035_1032279042 -9 Left 1032279035 7:130486424-130486446 CCTCCCCGTGCACCCTCGCAGCC 0: 1
1: 0
2: 1
3: 22
4: 280
Right 1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032279042 Original CRISPR CTCGCAGCCCGCTCCAGGAG TGG Intronic
900479811 1:2892647-2892669 CTCCCCACCCGCTCCTGGAGCGG - Intergenic
901836264 1:11926006-11926028 CCCGCAGGCCGCGCCAGGCGCGG + Exonic
904002891 1:27348922-27348944 CTGGCAGCCAGCTGCAGGAGCGG - Intronic
905183259 1:36179139-36179161 ATAGCAGCCCTCTCCAGGACAGG - Intronic
905285219 1:36874904-36874926 CTCTCAGCCCACTCCAGCAGAGG + Intronic
906203095 1:43972301-43972323 CTCTCAGCCAGCTCCAGCTGGGG - Exonic
906269239 1:44461433-44461455 CTCCAACGCCGCTCCAGGAGGGG - Intronic
906323155 1:44828976-44828998 CTGGCACCCCTCTCCAGGTGGGG - Exonic
909942758 1:81630257-81630279 CTCCCAGCCTTCTCCAGGAAAGG + Intronic
911122612 1:94311140-94311162 CTCCCAGACCTCTCCAAGAGAGG - Intergenic
912174628 1:107141074-107141096 CTCGGAGCCCGCACCCAGAGGGG - Exonic
914845647 1:151282368-151282390 GTCTCGGCCCGCACCAGGAGCGG + Exonic
923712071 1:236395683-236395705 CGCGGTGCTCGCTCCAGGAGCGG - Intronic
924144287 1:241058056-241058078 GTCGCAGCCAGCACCAGGAAAGG + Intronic
1067040354 10:42949776-42949798 CTCCCAGCTCCCTCAAGGAGAGG - Intergenic
1068820982 10:61377149-61377171 CTGGCTGGCCGCTCCAAGAGTGG + Intergenic
1069071959 10:63998503-63998525 CTAGCACCCTGCTCCAGCAGGGG + Intergenic
1074435564 10:113431426-113431448 CTTGCAGGCTGCTCCAGGTGAGG - Intergenic
1078868661 11:15323683-15323705 GTGGAAGCCCACTCCAGGAGAGG + Intergenic
1080952327 11:37049403-37049425 GTCGCAGCCAGCTCCAGGGAAGG + Intergenic
1084602730 11:70155786-70155808 CTTACGGCCCGCACCAGGAGGGG + Intronic
1085010952 11:73141705-73141727 CTTGCCGCCGGCTCCAGGTGGGG - Intronic
1088594354 11:111428750-111428772 CTGGTAGCCTGTTCCAGGAGTGG - Intronic
1090977942 11:131691964-131691986 CCCGCAGTCCCATCCAGGAGGGG - Intronic
1091548951 12:1523513-1523535 CTCACAGACAGCTCCTGGAGGGG - Intergenic
1096587841 12:52634684-52634706 CCCACTGCCAGCTCCAGGAGAGG - Intergenic
1102394701 12:112575699-112575721 GTCCCAGCCGGCTCCAGGAGAGG - Intronic
1102485462 12:113252385-113252407 CTCTCAGCCCGTTCCTGGTGGGG - Intronic
1103362285 12:120361494-120361516 CCCTCAGCTCGCCCCAGGAGGGG - Intronic
1105368860 13:19785453-19785475 CCTGCAGCCCTCTCCAGAAGTGG + Intergenic
1116868962 14:50053882-50053904 GTCGCAGCTCGCTCTAGCAGAGG + Intergenic
1117253238 14:53955110-53955132 TTCGCAGCCCGCCCCAGCGGTGG - Intronic
1119475052 14:74922437-74922459 CTCTCTGCTGGCTCCAGGAGGGG - Exonic
1119658817 14:76436259-76436281 CTCCCAGCCCCTCCCAGGAGAGG - Intronic
1121240967 14:92429891-92429913 CATGCAGCCAGCCCCAGGAGAGG - Intronic
1122558002 14:102591967-102591989 CACGCAGCTCGCGCCAGGGGAGG + Intergenic
1122728541 14:103777555-103777577 CCCACTGCCTGCTCCAGGAGAGG + Intronic
1122785168 14:104160176-104160198 CTCAAAGCCCGCTCCCTGAGAGG - Intronic
1122921288 14:104881368-104881390 CTCCCACCTCGGTCCAGGAGGGG + Intronic
1123469900 15:20541938-20541960 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123648155 15:22458743-22458765 GTCCCCGCCCACTCCAGGAGAGG - Intergenic
1123730194 15:23136960-23136982 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123748332 15:23334370-23334392 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123763101 15:23447417-23447439 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1124280710 15:28358257-28358279 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1124301994 15:28553372-28553394 GTCCCCGCCCACTCCAGGAGAGG - Intergenic
1125729608 15:41885812-41885834 CTGGCATCCTGCCCCAGGAGGGG - Exonic
1127776939 15:62270930-62270952 CTCCCCGCCCACTCCAGGAAAGG + Intergenic
1128783131 15:70376090-70376112 ATCACAGCACGCTCCAGGACTGG + Intergenic
1129878239 15:78990934-78990956 CTCGCAGCCCTCCCCAGCATGGG - Intronic
1131188717 15:90295587-90295609 CGTGGAGCCCGCACCAGGAGAGG + Intronic
1131558264 15:93417895-93417917 CTCCCAGCCTGCCCCGGGAGGGG - Intergenic
1132314431 15:100879821-100879843 TGCGCAGCCCGCTCCCGGGGTGG - Exonic
1132759742 16:1502840-1502862 CTCACAGCCAGCTCCAGCACAGG - Intronic
1134531899 16:14989929-14989951 CCCGCAGGCCGCGCCAGGCGCGG + Intronic
1137566752 16:49538108-49538130 CTGACAGCCCCCACCAGGAGAGG + Intronic
1139474577 16:67196594-67196616 GCTGCAGCCCTCTCCAGGAGTGG - Intronic
1140471766 16:75219213-75219235 CACACAACCTGCTCCAGGAGTGG + Intronic
1143098281 17:4490184-4490206 CTCGCAGCCCACAGCAGGACAGG + Intergenic
1145936544 17:28717782-28717804 CCCGCAGGCCGCTGGAGGAGGGG + Intronic
1147469770 17:40648256-40648278 CGCTGAGCCCGCTCCTGGAGGGG + Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1151572785 17:74935629-74935651 CTCGCAGCCCGCCCTCGGATGGG - Intergenic
1151657569 17:75502884-75502906 ATCCCAGCCCCCCCCAGGAGAGG - Exonic
1156023367 18:32624453-32624475 GTCGCAGCCAGATTCAGGAGAGG + Intergenic
1157529001 18:48406316-48406338 CTCTCACCCCTCTCCAGCAGGGG - Intronic
1159810333 18:73011726-73011748 CTGGGAGCCGGATCCAGGAGGGG + Intergenic
1160524329 18:79526190-79526212 CTCGCAGGCTGCTCCCGGACTGG - Intronic
1161644653 19:5445657-5445679 CTCCCAGCCAGGCCCAGGAGGGG - Intergenic
1164672752 19:30082322-30082344 CTCACAGTCCCCACCAGGAGGGG + Intergenic
1165423599 19:35733756-35733778 CTCGCAGGCCCCTCCAGGAACGG + Exonic
927705002 2:25291415-25291437 CTCCATGCCCACTCCAGGAGGGG + Intronic
928093980 2:28392993-28393015 CCCGGAGCCCGCTCCCGGACGGG - Exonic
931216812 2:60252776-60252798 CTGGCAGCCGGCTCCAGCACAGG + Intergenic
939880047 2:147620907-147620929 CTGGAAGCCTGCACCAGGAGAGG - Intergenic
946411266 2:219516363-219516385 CTCACACCCCTCTCCCGGAGAGG - Intronic
947672402 2:231946619-231946641 CAGGCAGCCCGGCCCAGGAGGGG - Intergenic
948949080 2:241237192-241237214 CACGCAGCCCCACCCAGGAGAGG + Intronic
1168837224 20:885310-885332 CCCGCAGCGCGCTCGAGAAGCGG - Exonic
1173114101 20:40223666-40223688 CTCACAGCCCTCTCCAGGTAGGG - Intergenic
1173251557 20:41366537-41366559 GGCGCAGGCCGCGCCAGGAGCGG + Exonic
1175199544 20:57267842-57267864 CTCTCACCCAGCCCCAGGAGGGG - Intergenic
1176514558 21:7774303-7774325 CCCGCTGCCCACTCCAGCAGAGG + Intergenic
1178648671 21:34404827-34404849 CCCGCTGCCCACTCCAGCAGAGG + Intronic
1181728950 22:24830931-24830953 ATCACAGCCCTGTCCAGGAGGGG - Intronic
1183407854 22:37639374-37639396 CCCGCAACCCGCCCCAGGCGGGG - Intronic
1183428231 22:37750954-37750976 CTCCCTGCCGGCGCCAGGAGCGG + Intronic
1185046549 22:48531361-48531383 CTCACTGTCCGCTCCAGGAAGGG - Intronic
1185065204 22:48628579-48628601 TTCGCCACCCCCTCCAGGAGAGG + Intronic
954367739 3:50155294-50155316 CCCGCAGCCCACCCCAGGGGAGG + Exonic
956403655 3:68905853-68905875 TTGGAAGCCTGCTCCAGGAGAGG - Intronic
968084047 3:195866783-195866805 CTCGCAGGCCGCTCCCGGCCAGG - Intronic
968628067 4:1637050-1637072 CAGGCAGCCCTCACCAGGAGAGG - Intronic
972437199 4:39045221-39045243 CTCGCAGCCGCCTCCGGGAGGGG - Intronic
972740632 4:41882952-41882974 CTCCCCGCGCGCTCCAGCAGAGG - Intergenic
976405815 4:84659563-84659585 CTAGCAGACAGATCCAGGAGGGG - Intergenic
978756806 4:112311653-112311675 TTCACAGCCAGCTCCAGGGGAGG + Intronic
984457963 4:179995224-179995246 ATTGCAGCCAGCTCCAGGAAGGG + Intergenic
984778608 4:183504946-183504968 CTCCCCTCCCGCTCCAGGACCGG - Intergenic
986993405 5:13579288-13579310 CGGGCAGCCCGCGCCAGCAGTGG + Intergenic
987129916 5:14850667-14850689 ACAGCAGCCAGCTCCAGGAGAGG - Intronic
992627723 5:78649353-78649375 CTCGCCGCCCTCTTCCGGAGAGG + Intronic
995479567 5:112581091-112581113 CTGCCAGCCCTCTGCAGGAGCGG - Intergenic
997640299 5:135444583-135444605 CTGGCAGCCCACTGCAGGGGTGG + Exonic
998140505 5:139697189-139697211 CCCCCACCCCGCCCCAGGAGGGG - Intergenic
999439632 5:151591281-151591303 CGCGCAGCCCGCAGCCGGAGAGG + Intergenic
1000331038 5:160205530-160205552 CTCCAACCCTGCTCCAGGAGAGG + Intronic
1002040966 5:176513987-176514009 CTCGCAGCCCTCTCCCAGCGGGG + Intergenic
1002344036 5:178535796-178535818 CTCACAGCCCTCTCCACGATGGG - Intronic
1007706128 6:43792517-43792539 TTCTCAGGCCTCTCCAGGAGAGG - Intergenic
1007781557 6:44257480-44257502 CCCGCCGCCGCCTCCAGGAGCGG + Exonic
1019337184 7:491034-491056 CTCCCAGCCCTCTCCGGAAGGGG + Intergenic
1019454927 7:1122048-1122070 CTCGCAGCCAGCCACAGGAAGGG + Intronic
1027333779 7:77127006-77127028 ATCTGAGCCAGCTCCAGGAGAGG + Intronic
1029223874 7:99011095-99011117 CGCGCAGCATGCTCAAGGAGTGG + Exonic
1029376032 7:100177432-100177454 CTCGGAGCCGGCTTCAGGGGCGG + Intergenic
1029782016 7:102744326-102744348 ATCTGAGCCAGCTCCAGGAGAGG - Intergenic
1032279042 7:130486438-130486460 CTCGCAGCCCGCTCCAGGAGTGG + Intronic
1035074983 7:156171209-156171231 CACACAGCTCTCTCCAGGAGAGG - Intergenic
1038963596 8:32548401-32548423 CTCGCAACCCGATCGGGGAGAGG - Intronic
1039243524 8:35582735-35582757 CTTTCATCCCTCTCCAGGAGTGG + Intronic
1039780397 8:40779489-40779511 CTCTCAGCTCTCCCCAGGAGTGG - Intronic
1040462155 8:47659567-47659589 CTCCCAGGCGGCTACAGGAGTGG + Intronic
1046619191 8:116509713-116509735 CTCGCAGCCCTCTCCAGTGGTGG - Intergenic
1047496671 8:125413739-125413761 CTCACTGCCCTCTCCAGGAGGGG - Intergenic
1052888884 9:33677167-33677189 TTCTCCCCCCGCTCCAGGAGGGG + Intergenic
1055321554 9:75088086-75088108 CCCGCAGCTCGCTCCCCGAGAGG + Exonic
1057941570 9:99289625-99289647 CTCTCAGCCCCATCCTGGAGGGG + Intergenic
1058878464 9:109265394-109265416 CTCTCAGCCAGCTCCACCAGCGG + Intronic
1059438184 9:114288860-114288882 CTCCCAGCCCTCTGCAGGATGGG + Intronic
1060530726 9:124345917-124345939 CTCCCAGCCCGCTCCTGGTCAGG + Intronic
1062641556 9:137521153-137521175 CTGACAGCCCTGTCCAGGAGAGG - Intronic
1186638064 X:11427480-11427502 CTCGCAGTCCCCACCCGGAGCGG + Intronic
1188033241 X:25288131-25288153 CTGGCAGCCAACTGCAGGAGTGG - Intergenic
1200821787 Y:7591783-7591805 CTTGCAGCCCACCCAAGGAGAGG - Intergenic
1202103812 Y:21340038-21340060 CTTGCAGCCCACCCAAGGAGAGG - Intergenic
1202238518 Y:22740971-22740993 CTTGCAGCCCACCCAAGGAGAGG + Intergenic