ID: 1032280301

View in Genome Browser
Species Human (GRCh38)
Location 7:130494467-130494489
Sequence TGCCTTTGAAGTCCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032280296_1032280301 17 Left 1032280296 7:130494427-130494449 CCTGTTTGGCACTCCTTGTCAAT 0: 1
1: 0
2: 1
3: 4
4: 95
Right 1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG No data
1032280298_1032280301 4 Left 1032280298 7:130494440-130494462 CCTTGTCAATGTGGATAAACTGA 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1032280301 7:130494467-130494489 TGCCTTTGAAGTCCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032280301 Original CRISPR TGCCTTTGAAGTCCTGGGCA TGG Intronic
No off target data available for this crispr