ID: 1032298176

View in Genome Browser
Species Human (GRCh38)
Location 7:130661500-130661522
Sequence GAACCCTGAATTTCTGCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032298173_1032298176 11 Left 1032298173 7:130661466-130661488 CCACAATACTCATAGTGGTTCTG 0: 1
1: 0
2: 3
3: 15
4: 125
Right 1032298176 7:130661500-130661522 GAACCCTGAATTTCTGCTACAGG No data
1032298171_1032298176 18 Left 1032298171 7:130661459-130661481 CCTAATTCCACAATACTCATAGT 0: 1
1: 0
2: 2
3: 16
4: 158
Right 1032298176 7:130661500-130661522 GAACCCTGAATTTCTGCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032298176 Original CRISPR GAACCCTGAATTTCTGCTAC AGG Intronic
No off target data available for this crispr