ID: 1032299770

View in Genome Browser
Species Human (GRCh38)
Location 7:130675937-130675959
Sequence CTCAACTAGGAGTGGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032299758_1032299770 24 Left 1032299758 7:130675890-130675912 CCCAGCCTATGAATTTTGCTTTG 0: 1
1: 0
2: 2
3: 26
4: 332
Right 1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG 0: 1
1: 0
2: 1
3: 16
4: 167
1032299761_1032299770 19 Left 1032299761 7:130675895-130675917 CCTATGAATTTTGCTTTGTTGGG 0: 1
1: 0
2: 2
3: 22
4: 290
Right 1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG 0: 1
1: 0
2: 1
3: 16
4: 167
1032299759_1032299770 23 Left 1032299759 7:130675891-130675913 CCAGCCTATGAATTTTGCTTTGT 0: 1
1: 0
2: 2
3: 30
4: 369
Right 1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG 0: 1
1: 0
2: 1
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032299770 Original CRISPR CTCAACTAGGAGTGGGGACA CGG Intronic
900583444 1:3420806-3420828 TTGAACTGGGAGTGGGGAGAGGG + Intronic
902087481 1:13874622-13874644 CTCAAGTAGGAATGGGGTGAGGG - Intergenic
902779196 1:18693587-18693609 CTAATCTGGGAGTGAGGACAGGG - Intronic
903435954 1:23349379-23349401 CTCACCTAGGATGGAGGACAGGG - Intergenic
903542768 1:24106195-24106217 CTCAGCTAGGGGAGGGGACCGGG - Intronic
904698930 1:32346813-32346835 CTGAACTAGGCGAGGGAACAGGG + Intergenic
904985784 1:34547392-34547414 GTCAAGTAGGAGTGGGAGCATGG + Intergenic
908201523 1:61800803-61800825 CTCACCTATGAGTGAGAACATGG + Intronic
909675477 1:78234835-78234857 TTCAATTAGGAGAGGGGCCAAGG + Intergenic
911327243 1:96482702-96482724 TTGAACTGGGAGTGGGGAGAAGG + Intergenic
912504604 1:110147755-110147777 CTCAAGAAGGTGTGGGGCCATGG + Intergenic
912966040 1:114238377-114238399 CTCAACTAGGGGTAGCCACAAGG + Intergenic
920565696 1:206970934-206970956 CTCAACAATGAATGGGCACAAGG + Intergenic
920869278 1:209780380-209780402 AACCACTAGGAGTGGGGAGAGGG - Exonic
923447610 1:234087177-234087199 CTCATCTAGGGATGGGGAAAGGG + Intronic
924707068 1:246510096-246510118 GTCCACTGGGAGTCGGGACATGG + Intergenic
1067338027 10:45379902-45379924 CCCACCGAGGAGTGGGGAGAGGG - Intronic
1067428328 10:46225874-46225896 TGCAACCAGGAGTGGGGATATGG - Intergenic
1067574490 10:47400583-47400605 CTCCACTGGGACTGGGGTCAGGG - Intergenic
1069764673 10:70845766-70845788 CCCTACTAAGAGTGGGGAAAAGG - Intronic
1070480154 10:76874369-76874391 CTAAGTTAGGAGTGGGAACATGG - Intronic
1071781748 10:88853972-88853994 CACAACTAGGAGTGGGAGCATGG + Intergenic
1073214393 10:101828613-101828635 CTCAAGGAGGTGAGGGGACAAGG - Exonic
1073895032 10:108145707-108145729 CTAAACTGGGAGTGGGGACTGGG - Intergenic
1075559823 10:123460390-123460412 CTGGACTGGGAGTGGGGACTAGG - Intergenic
1076564281 10:131387386-131387408 CTGAAGTGGGAGTGGGCACAGGG - Intergenic
1076841239 10:133046708-133046730 CTCAGCTGGGAGATGGGACAGGG - Intergenic
1077304910 11:1864685-1864707 CTGAAGTAGGAGAGGGGAAAGGG + Intronic
1077652951 11:3990956-3990978 CTCCAAAAGGAGTGGGGATAGGG - Intronic
1078387733 11:10907861-10907883 CAGAACTAGGAGTGAAGACACGG + Intergenic
1083996312 11:66274773-66274795 CTCAACAGGGAGGGGGGACAGGG - Intronic
1084640122 11:70420780-70420802 TTTACCCAGGAGTGGGGACATGG + Intronic
1084936976 11:72592130-72592152 CCCAAGTAGGAGTGGGGGAAGGG - Intronic
1089046077 11:115503474-115503496 CTCTGCCACGAGTGGGGACACGG - Intronic
1089560898 11:119342591-119342613 CTCACCTGGGGGTGGGAACAAGG + Exonic
1089793673 11:120963052-120963074 CTCTACTAGCAGTGGGAAGAAGG + Intronic
1093949712 12:25151175-25151197 CTCAACTAGCAGTGGGGTCTTGG + Intronic
1096623547 12:52879367-52879389 CTGAACTGAGAGTGAGGACACGG + Intergenic
1097420568 12:59373469-59373491 CTCACCTAGGATGGGGAACATGG - Intergenic
1098228396 12:68348211-68348233 CTCACCTAAAAATGGGGACAGGG - Intergenic
1100190672 12:92187883-92187905 CTGGACTAGGAATGAGGACAAGG - Intergenic
1100589082 12:96008051-96008073 CACTACTAGGAGTGGGGCAAGGG + Intronic
1101567286 12:105920188-105920210 CTCAGCTAGGCCTAGGGACAAGG - Intergenic
1101682295 12:106981099-106981121 CTCAACAGGGAGTGGGGAGCGGG - Intronic
1102348188 12:112172857-112172879 CGCACCTTGGGGTGGGGACAGGG + Exonic
1102890215 12:116552841-116552863 CTGAGGAAGGAGTGGGGACAGGG + Intergenic
1103216747 12:119207541-119207563 CTTCACTAGGGGTGGGCACATGG + Intronic
1103902676 12:124311546-124311568 CTCAACAAGGGGTGTGGTCATGG - Intronic
1108510963 13:51155602-51155624 CTCAGATAAGAGTGGGGACCAGG - Intergenic
1108694245 13:52888746-52888768 CTCAGCTAATGGTGGGGACATGG + Intergenic
1110082679 13:71335930-71335952 CACAACTAGGAGTGGGGTATGGG + Intergenic
1116864397 14:50019709-50019731 CTAAACTAGGAGAGGTGGCAGGG - Intergenic
1119581756 14:75790618-75790640 CTTAGCTGGGTGTGGGGACATGG - Intronic
1121528336 14:94635016-94635038 CTCAGCTAGGAGAGTGGAAATGG - Intergenic
1126400881 15:48268852-48268874 TTCAACTAGGAATGGGAATATGG + Intronic
1128244453 15:66123660-66123682 CTCAACCAGGGATGGGGAGATGG - Intronic
1129227421 15:74178255-74178277 CTCAGCTAGGAATGGAGCCAGGG - Intergenic
1132369770 15:101287408-101287430 CTCACCTACGAGTGAGAACATGG + Intronic
1133572907 16:7059282-7059304 CTCACCAAGGGGTGGGGAGAAGG - Intronic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1135895162 16:26394459-26394481 CTCACATTGGAGTGAGGACACGG - Intergenic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1137721735 16:50631557-50631579 CACAGCCAGGTGTGGGGACAGGG + Intronic
1139737782 16:69006913-69006935 CTCGACTGGGAATGGGTACAAGG - Intronic
1143238770 17:5426119-5426141 CTCACCTTGGAGTGGGGAATGGG - Intronic
1144047377 17:11466095-11466117 CTGAACTAGGAGTGGGGCCCAGG + Intronic
1145238047 17:21222898-21222920 CCTAACTAGGAGTGGGCAGAAGG - Intergenic
1146659230 17:34653391-34653413 CTTAACTTGGGGAGGGGACATGG + Intergenic
1146980886 17:37160463-37160485 ATCAGCTAAGAGTGGGGAGAGGG + Intronic
1148557865 17:48589368-48589390 CTGAACCAGGAGTGGGGGAAGGG - Intronic
1150440216 17:65185127-65185149 CTCTTCTAGGAGTGTGTACAGGG - Intronic
1150882204 17:69042892-69042914 CACAAACAGGAGTGGGGAGATGG + Intronic
1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG + Intergenic
1154191030 18:12231284-12231306 CTCAGGTAGGGGTGGGGACTGGG + Intergenic
1156694142 18:39746782-39746804 CTTGACTAGGAGTGGGAATATGG - Intergenic
1161983467 19:7642255-7642277 CTCATGCAGTAGTGGGGACACGG - Exonic
1163038672 19:14586828-14586850 CTCAACTGGGAGCGGGGAGGTGG + Intronic
1165473551 19:36016871-36016893 GTCACATAGGAGAGGGGACAGGG + Intronic
1166338682 19:42123946-42123968 CTTTAGTAGGAGTGGGGTCATGG - Intronic
1167050570 19:47075397-47075419 CTCAACTGTGTGTGGGGCCATGG + Intronic
926204972 2:10829351-10829373 CTCAACTAAGAGAGGGGACAGGG - Intronic
927939472 2:27094709-27094731 CTCCAAAAGGAGTGGGGAGAGGG - Intronic
928070851 2:28214654-28214676 CCCACCTAGGATTGGGAACAAGG - Intronic
930063889 2:47312819-47312841 CTAAATCAGGGGTGGGGACAGGG + Intergenic
931239305 2:60438462-60438484 CTCAACAAGGAGTGAAGACACGG - Intergenic
932060322 2:68491460-68491482 CATATCTAGGAGTGGGAACATGG + Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
939181356 2:138806240-138806262 ATCAAATATGAGTGAGGACACGG - Intergenic
943715995 2:191152295-191152317 CTCAACAAGCAGTGGGGACCAGG - Intergenic
944171680 2:196786378-196786400 ATCAACTGAGAGTGGGGACTGGG - Intronic
944315886 2:198285403-198285425 CTGAATTAGGAGTGGGCATATGG + Intronic
944504811 2:200400000-200400022 CTCCACTTGGAGGGGGGAAATGG - Intronic
945215439 2:207429053-207429075 CTCAACTCGGTGTGGAGGCATGG + Intergenic
945991297 2:216397531-216397553 CTCAACAAGGACAGGGAACAGGG + Intergenic
946895247 2:224317820-224317842 CCCACCTATGAGTGAGGACATGG - Intergenic
947017833 2:225641133-225641155 CTCCTCTAGGAGAGGGCACAGGG - Intronic
1170412183 20:16103881-16103903 TTCAACATGGAGTGGGGACTGGG - Intergenic
1171503136 20:25610238-25610260 AACAAGTTGGAGTGGGGACAGGG - Intergenic
1173534433 20:43798593-43798615 CTCGTCTAGGACTGGGGGCAGGG + Intergenic
1174395046 20:50242147-50242169 CACAGCTAGGAGGGGGGACCAGG - Intergenic
1175494269 20:59403338-59403360 CTGGACTAGGTGCGGGGACAGGG - Intergenic
1179829563 21:43988084-43988106 CTCACCCAGGAGAGGGGCCAAGG + Intergenic
1180784477 22:18539189-18539211 CTCAAGTAGGCTTGGGGACTGGG - Intergenic
1181055513 22:20258873-20258895 CTCAGCTAGGAGTGGGGCGTGGG + Intronic
1181241380 22:21478546-21478568 CTCAAGTAGGCTTGGGGACTGGG - Intergenic
1183110830 22:35647188-35647210 CTCAGCTAGGGGTGGTGACTGGG + Intergenic
1183991028 22:41597140-41597162 CTGAACAAGGGGTGGGGAAAGGG + Intergenic
1184689490 22:46110928-46110950 CTCACCCAGGAGTGGGGACCAGG - Intronic
950843990 3:15996755-15996777 TTCAACAAGGAGAGGGGAAAAGG - Intergenic
954634012 3:52061833-52061855 CTGAGCTAGCGGTGGGGACAGGG - Intergenic
955322812 3:57986364-57986386 CTCCACTTGGAGAGGGGAGATGG + Intergenic
960822939 3:121753291-121753313 GTCACCTAGGAGTAGTGACAGGG - Intergenic
962841256 3:139234934-139234956 CTCATCCAGGAGTGGAGTCAGGG - Intronic
969723149 4:8904379-8904401 CGCAACAAGGAGTGGGAAGATGG + Intergenic
970445654 4:16121349-16121371 CTCAACTCAGGGTGGGGACATGG + Intergenic
971149148 4:24012636-24012658 TTCTACCAGGTGTGGGGACAAGG - Intergenic
973063635 4:45761608-45761630 CTCCACTGGCAGTGGGCACAAGG + Intergenic
973194933 4:47428741-47428763 CTTGGCTAGGAGTGGGGCCAAGG - Intergenic
974034048 4:56801920-56801942 CTCAACTAGGAGTTTAGAGAGGG + Intergenic
975495384 4:75030769-75030791 GTCCACTGGGAGTGGAGACATGG - Intronic
976122553 4:81799394-81799416 ATCACCTAGCAGTGGGGACCTGG + Intronic
976424368 4:84883700-84883722 CTCAACTAGAGCTGGGGAAAAGG + Intronic
979519794 4:121653022-121653044 GTCAACCAGGAGAAGGGACAAGG + Intergenic
981584567 4:146286934-146286956 CTGAACTTGGAGTGGTGAGAAGG + Intronic
981959063 4:150513678-150513700 CTCCACTATGTGAGGGGACAGGG - Intronic
983479983 4:168260906-168260928 TTCAACTAGAAGTGGAAACATGG + Exonic
983671824 4:170246606-170246628 CTCAACTACTGATGGGGACAGGG + Intergenic
985345309 4:188998709-188998731 GTCAAATAGGAGTGGTGAGAGGG + Intergenic
985536619 5:468592-468614 CTCACCTGGGGGTGGGGACAGGG - Intronic
987671813 5:21019412-21019434 CTCAACAAAGAGAGGGGACCTGG - Intergenic
988790735 5:34605044-34605066 CTAAACTTGGGGTGGGGCCATGG - Intergenic
989622578 5:43399281-43399303 CTGAACTAAGAGTGGTAACAAGG - Intronic
998163039 5:139824156-139824178 CCCAGCCAGGGGTGGGGACAGGG - Intronic
998173073 5:139883650-139883672 CTCACCTAGTAGAGGGGCCAGGG - Intronic
999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG + Intronic
999247978 5:150165549-150165571 GTGAACTGGGAGTGGGGACAAGG - Intergenic
1000259289 5:159570946-159570968 GCCAAATGGGAGTGGGGACAAGG - Intergenic
1002877748 6:1226470-1226492 ATCAGCTGGGAGTGGGGATAAGG + Intergenic
1002964617 6:1951066-1951088 CTCAACTAGGGGTGGGGAATGGG - Intronic
1003248493 6:4404025-4404047 CTCAGCTGAGGGTGGGGACAAGG + Intergenic
1007967106 6:46013719-46013741 CACACCTAGGAGTGGGGCAAAGG + Intronic
1008677000 6:53829683-53829705 CTCAGCTAGGAGTAGGAACTTGG + Intronic
1014135712 6:117886538-117886560 CTCAATTAGTAGTGGAAACATGG - Intergenic
1016851075 6:148619629-148619651 CCAAACCAGGAGTGGGCACATGG - Intergenic
1019065459 6:169292335-169292357 CTGTGCTTGGAGTGGGGACAAGG + Intergenic
1022823676 7:33986997-33987019 CTCAAGTAGGACCAGGGACAGGG - Intronic
1024350759 7:48360262-48360284 CCCACCTATGAGTGAGGACATGG + Intronic
1024550906 7:50561673-50561695 ATCAACCAGGAGTGGGGGGAGGG - Intronic
1025901632 7:65749812-65749834 CACAACTAGGAGCCGGGGCACGG - Intergenic
1027424603 7:78049639-78049661 CACAACTAGAAGTGGAGAAAAGG - Intronic
1030896310 7:115065195-115065217 CTCACTTAGGAGTGGAGATAGGG - Intergenic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1033875930 7:145818292-145818314 CTCACCTATGAGTGAGAACATGG + Intergenic
1038070625 8:24008707-24008729 CTAAACTAGGAAGGGGGAGAGGG - Intergenic
1038985453 8:32804167-32804189 CTGAATTAGGAGTCAGGACAGGG - Intergenic
1040385091 8:46909691-46909713 CTCAACTGGGAGGGGAGAAACGG - Intergenic
1043924896 8:86025805-86025827 ATCAACCAGGAGTGGTGACATGG + Intronic
1044775141 8:95679078-95679100 TTGGATTAGGAGTGGGGACAGGG + Intergenic
1045681320 8:104663493-104663515 CTCAACTAGCAGTGGGACCTAGG - Intronic
1045969614 8:108064938-108064960 CCCAACTATGAGTGAGAACATGG - Intronic
1047413201 8:124641115-124641137 CTCATCTGGGGGAGGGGACATGG + Intronic
1048792011 8:138112831-138112853 CTCAAGTGGGGGTGGAGACAGGG + Intergenic
1048850634 8:138642052-138642074 CTCAACAATAAGTGGTGACAAGG + Intronic
1050512202 9:6407865-6407887 CTCAGGTAGGAGTGGGGACCTGG - Intergenic
1052065730 9:24017289-24017311 CTCATCTATGAGTGAGAACATGG + Intergenic
1057143835 9:92745422-92745444 CCTAACTAAGGGTGGGGACAGGG + Intronic
1057421088 9:94913051-94913073 ACCACCTAGGAATGGGGACATGG + Intronic
1060593755 9:124835504-124835526 CTCTCCTAGGAGTGGGATCATGG - Intergenic
1061015224 9:127977496-127977518 GTGAGCTGGGAGTGGGGACAGGG - Intronic
1061194983 9:129102669-129102691 CTCATCTGGGAGTGGGAGCAGGG - Intronic
1185944882 X:4364360-4364382 CTAATTTAGGAGTGGGGACAAGG + Intergenic
1186153463 X:6701085-6701107 CTCCATTAGCAGTGGGGGCAAGG - Intergenic
1186290772 X:8096106-8096128 CTAAACTTGGTGTGGGGAAATGG - Intergenic
1188964203 X:36530748-36530770 CTAAACAAGTAGTGGGCACATGG + Intergenic
1189108243 X:38258824-38258846 CACAACTTGGAGTGGGGAGGTGG - Intronic
1189292269 X:39894826-39894848 CTCCACCAGGGGAGGGGACAGGG + Intergenic
1190244410 X:48681752-48681774 CTTAGCTGTGAGTGGGGACACGG + Intronic
1190309458 X:49106542-49106564 CTTAGCTGTGAGTGGGGACATGG + Intergenic
1194043220 X:88969800-88969822 CACATGTAGGAGTAGGGACATGG - Intergenic
1195399949 X:104450560-104450582 CTCAACAAGGTCTGGGGATAGGG + Intergenic
1200564763 Y:4751681-4751703 CTCACCTATGAGTGAGAACATGG + Intergenic