ID: 1032303000

View in Genome Browser
Species Human (GRCh38)
Location 7:130707183-130707205
Sequence CTCGTCAGTCCCTGGTTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032303000_1032303004 14 Left 1032303000 7:130707183-130707205 CCACATAACCAGGGACTGACGAG No data
Right 1032303004 7:130707220-130707242 GATAGATGACAATGAGATTTAGG No data
1032303000_1032303003 -8 Left 1032303000 7:130707183-130707205 CCACATAACCAGGGACTGACGAG No data
Right 1032303003 7:130707198-130707220 CTGACGAGGCATCAGATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032303000 Original CRISPR CTCGTCAGTCCCTGGTTATG TGG (reversed) Intergenic
No off target data available for this crispr