ID: 1032305405

View in Genome Browser
Species Human (GRCh38)
Location 7:130729408-130729430
Sequence TTTGGTATACACAGGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032305405_1032305408 -6 Left 1032305405 7:130729408-130729430 CCAGGATCCCTGTGTATACCAAA No data
Right 1032305408 7:130729425-130729447 ACCAAAATCCACGCATACCCAGG No data
1032305405_1032305411 3 Left 1032305405 7:130729408-130729430 CCAGGATCCCTGTGTATACCAAA No data
Right 1032305411 7:130729434-130729456 CACGCATACCCAGGCCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032305405 Original CRISPR TTTGGTATACACAGGGATCC TGG (reversed) Intergenic
No off target data available for this crispr