ID: 1032306114

View in Genome Browser
Species Human (GRCh38)
Location 7:130733793-130733815
Sequence GCGCGGCGCCGCCCGCGCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 6, 3: 54, 4: 437}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032306103_1032306114 7 Left 1032306103 7:130733763-130733785 CCGCCCAGACGCTTGCAGCCAGC 0: 1
1: 0
2: 2
3: 17
4: 189
Right 1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG 0: 1
1: 0
2: 6
3: 54
4: 437
1032306104_1032306114 4 Left 1032306104 7:130733766-130733788 CCCAGACGCTTGCAGCCAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG 0: 1
1: 0
2: 6
3: 54
4: 437
1032306101_1032306114 26 Left 1032306101 7:130733744-130733766 CCAGAGCTGCCGCGCAAGTCCGC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG 0: 1
1: 0
2: 6
3: 54
4: 437
1032306102_1032306114 17 Left 1032306102 7:130733753-130733775 CCGCGCAAGTCCGCCCAGACGCT 0: 1
1: 0
2: 0
3: 2
4: 21
Right 1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG 0: 1
1: 0
2: 6
3: 54
4: 437
1032306106_1032306114 3 Left 1032306106 7:130733767-130733789 CCAGACGCTTGCAGCCAGCAGGT 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG 0: 1
1: 0
2: 6
3: 54
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032306114 Original CRISPR GCGCGGCGCCGCCCGCGCCG GGG Exonic
900091751 1:923866-923888 CCGCGCCGCCCGCCGCGCCGGGG + Intergenic
900195802 1:1374964-1374986 GCGCGACACCGCCCGCGTCGGGG - Exonic
900269174 1:1778424-1778446 GCTCGGCGGCGCCGGCGCCGGGG - Intronic
900287540 1:1908834-1908856 GCCAGCAGCCGCCCGCGCCGCGG - Intergenic
900513014 1:3069318-3069340 GCGCCGCGCCGCCGGGGCCCGGG + Intronic
901361324 1:8703282-8703304 GCGGGGCCCCGCCCGCGGCTAGG + Intronic
901540075 1:9910040-9910062 GCGCGGCGCGGCGCGGGCCCGGG + Intronic
903132731 1:21290232-21290254 GCGCGGCGGCGGCGGCGCCAGGG - Intronic
903184671 1:21622424-21622446 GCCCGGCCCGGCCCCCGCCGGGG + Intronic
903466418 1:23555058-23555080 GCGCTGCGGCGCCCGGGCTGGGG - Intergenic
903700819 1:25247123-25247145 GGCGGTCGCCGCCCGCGCCGTGG - Intronic
904160434 1:28518638-28518660 GCGCGCGGCCGCCCGGGCGGGGG + Intronic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904190208 1:28737347-28737369 ACGCGGCGCGGCCCGGCCCGTGG - Intronic
904236813 1:29122006-29122028 GCGGGGAGCCGCCCGCGCTCGGG + Intronic
904252747 1:29236617-29236639 GAGCGTCGCCGCCCGTCCCGGGG - Exonic
904701812 1:32362291-32362313 GCGAGGCGGCGTCCACGCCGAGG + Exonic
904813820 1:33181162-33181184 GCGCGGCGCGGCGCGCGTTGAGG + Exonic
904822935 1:33256792-33256814 GCCCGGGGCCGCCTGCGCCTCGG + Intronic
905037828 1:34929348-34929370 CCCCGGCGCCGCCCACGCCCCGG - Intronic
905819808 1:40980291-40980313 GGGCGGCTGAGCCCGCGCCGAGG - Intronic
906044492 1:42817306-42817328 GCGCGGCCCCGCCCAGGACGAGG - Intronic
906293021 1:44632093-44632115 GCGCGGTGCCGCCCCAGCCCTGG - Intronic
906650300 1:47508215-47508237 GCGGGGCGCCCGCCGCGGCGTGG + Intergenic
906680937 1:47725149-47725171 GCGCATGGCCGGCCGCGCCGGGG + Intergenic
907213516 1:52842981-52843003 CCGCGTCGCCGCCCGCACCCCGG - Intronic
907682639 1:56578765-56578787 GCGCCGCGCCGTCAGCTCCGGGG - Intronic
909475222 1:76074639-76074661 GGGCGGGGCCGCGCGGGCCGCGG + Intergenic
910838092 1:91535679-91535701 GCGCGGCGCCCGCCTCGCCCAGG - Intergenic
910981246 1:92961551-92961573 GCGCGGCGCGCGCCGCGGCGGGG - Intergenic
911052362 1:93681676-93681698 GCCTCGCACCGCCCGCGCCGCGG + Intronic
911072969 1:93846972-93846994 GCGCGGCGGCGCTCGCGCGCAGG + Intronic
911133799 1:94418316-94418338 CCGCCGCGCCGCCCGCGCTCTGG - Intergenic
912716966 1:111989874-111989896 GCGCGGCGCCGGCAGCGGCGGGG - Intergenic
912800187 1:112715326-112715348 CCGCGGCCCCGCCCCCGCCCAGG + Exonic
914869123 1:151458819-151458841 GCGCGCCGCGGCGGGCGCCGGGG + Intronic
914937452 1:151993542-151993564 GGGCGGCCGCGCCCGGGCCGGGG + Intronic
916667037 1:166975742-166975764 GCTCGGCGCGGCCCGCGGGGCGG - Intronic
916729473 1:167553435-167553457 GCACGCCGCTGCCCGCGCCCGGG + Exonic
916773451 1:167936203-167936225 GCTCGACCCCGCCCGCGCCTCGG - Intronic
920002410 1:202808571-202808593 GCGCGGCCCCGCCCGATTCGGGG - Exonic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
921029700 1:211326761-211326783 GCGCCCCTCCGCCCGCGCCCCGG + Intronic
922496501 1:226062226-226062248 GCGCGCCGGGGCCCGCGCGGGGG + Intronic
922505228 1:226122151-226122173 CCGCGGCCACGCCAGCGCCGGGG - Intergenic
922526642 1:226309250-226309272 GCGCTGCGCTGCTCCCGCCGCGG + Exonic
1062843718 10:689461-689483 GCGCGGCCCGGCCCGGGGCGGGG + Intronic
1064022877 10:11823626-11823648 GCCCGGCGCCGCCGCCGCAGAGG + Intronic
1064208973 10:13347779-13347801 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1064244270 10:13656918-13656940 GCGCGGCGGCGGCGGCGACGAGG - Exonic
1064274197 10:13891771-13891793 CCCCGCCGCCGCCCCCGCCGCGG + Intronic
1064397863 10:14995961-14995983 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1064764754 10:18659552-18659574 GCTCCGCGCAGCCCGCGCCGCGG + Exonic
1065214899 10:23439571-23439593 GCGCGGCGCCGGCGGCTCCCGGG - Exonic
1066080628 10:31928140-31928162 GCCCGGCCCCTCCCGCGCCCTGG - Intronic
1070800820 10:79243510-79243532 GCTCCGCGCTGCCCGCTCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1070877534 10:79827070-79827092 GCCCAGCCCCGCCCGCGGCGAGG + Intergenic
1071532572 10:86401018-86401040 GCCCCGCGCCGCCCGCCCCAGGG + Intergenic
1071644029 10:87343116-87343138 GCCCAGCCCCGCCCGCGGCGAGG + Intergenic
1072421106 10:95291067-95291089 GGGCGGAGCCGCCCCCGCCCTGG - Intergenic
1072454105 10:95561261-95561283 GCTCGGCGGCGGCAGCGCCGGGG - Intronic
1074121681 10:110498076-110498098 GCCCCGCGCCGCGCGCCCCGCGG - Exonic
1074772436 10:116742638-116742660 GCGGGGCGCCGGGCGGGCCGGGG - Intergenic
1076372495 10:129964388-129964410 GCGCGGCGGCGGCGGCGGCGAGG - Intergenic
1076749889 10:132537420-132537442 CCGCCCCGCCCCCCGCGCCGCGG - Intergenic
1076779119 10:132714271-132714293 GCGCGGCCCGCCCCACGCCGCGG - Intronic
1076849997 10:133088061-133088083 GCGCTGCGCTCCCCCCGCCGGGG - Exonic
1077121509 11:910955-910977 GCGCGGCCCCGCCCCGGCCCCGG - Intronic
1077576514 11:3387484-3387506 GCGCCGCGCCCCCCGCGATGCGG - Intergenic
1078180006 11:9003716-9003738 GCGCGAAGCCGCCGGGGCCGGGG + Intronic
1078594449 11:12674566-12674588 GCGCGGCGGGGCCCGGGCCCGGG + Intergenic
1078800896 11:14643632-14643654 TCCCGCCGCCACCCGCGCCGCGG - Intronic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1080034872 11:27700414-27700436 GCGCGGCGGCGGCAGCGTCGGGG + Intronic
1080802100 11:35618651-35618673 GCGGGGCGCCGCCGCCACCGCGG + Exonic
1081705637 11:45180806-45180828 GCGCGCCGCCCCCTGCCCCGTGG - Intronic
1081845597 11:46238350-46238372 GCGCCGCGCCGCCTCCGCCCGGG - Intergenic
1082807297 11:57459293-57459315 TCGCCCCGCTGCCCGCGCCGCGG - Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083168388 11:60906274-60906296 CCGCTGCGGCGCCCGGGCCGGGG - Intronic
1083437604 11:62653269-62653291 GCGCTCCGCCGCTCGCGCCTCGG - Exonic
1083562104 11:63681321-63681343 ACGCGGCGCCTCGCGCGCCGAGG - Intergenic
1083659806 11:64246782-64246804 CCCCGCCGCCGCCCTCGCCGCGG - Exonic
1083885770 11:65572834-65572856 GAGCCGCGCCGCCCGCGCCCCGG + Exonic
1083939980 11:65890610-65890632 ACGCGGCGGGGCGCGCGCCGGGG - Exonic
1084000152 11:66291782-66291804 CGGCGGCGCCGCCGGTGCCGCGG + Intergenic
1084228386 11:67732034-67732056 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1084228409 11:67732112-67732134 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1084806774 11:71584617-71584639 GCGAGGCGCCCCCCGCGATGCGG + Intronic
1085011244 11:73142710-73142732 GAGCGGAGACGCGCGCGCCGGGG - Intergenic
1085176646 11:74493723-74493745 GCGGGGCCCCGCCCTCTCCGTGG + Exonic
1085474843 11:76783302-76783324 GCGCGGCGCGGCCCGCCCCCCGG - Intronic
1086064907 11:82733809-82733831 GCGCCGCGCGCGCCGCGCCGGGG - Exonic
1087014623 11:93543239-93543261 GCGCGGCGGCGGCGGCGGCGGGG - Intronic
1090345017 11:126062737-126062759 GAGCGGCGCCTCGCACGCCGGGG + Intronic
1091473934 12:753485-753507 GGGCCGAGCCGCCCGCGCAGAGG - Exonic
1091718413 12:2795538-2795560 CCGCCGCCCCGCGCGCGCCGGGG - Intronic
1092385327 12:8032578-8032600 GCTCGGCGCTGCCCGCGGCTCGG + Intergenic
1094025856 12:25959000-25959022 GCGCGGCGCGGGGAGCGCCGGGG + Intergenic
1095752289 12:45727098-45727120 GAGCGGTGCCGACCGGGCCGTGG + Intergenic
1097777760 12:63668306-63668328 GCGCGGGGCCTCCCTCGCCCGGG - Exonic
1097981744 12:65742540-65742562 CCGCGGGGCCACCCCCGCCGCGG + Intergenic
1098973462 12:76878891-76878913 CCGCGGCGCCGCCAACCCCGGGG - Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1101640129 12:106581629-106581651 GCGCTTCCCCGCCCCCGCCGCGG + Intronic
1103510090 12:121467742-121467764 GCCCGGGGGCGCCCGGGCCGTGG + Intronic
1103561100 12:121793644-121793666 GCGCGCCGCCGCCAGTGCTGCGG - Exonic
1103561284 12:121794354-121794376 GCCCGGAGCGGCCGGCGCCGAGG - Intronic
1103899325 12:124295271-124295293 GCCCGGCGCCCCCCGCGCCCCGG - Intronic
1104049652 12:125186807-125186829 GAGCGGCGGCGCCCGGCCCGGGG - Intergenic
1104961487 12:132490345-132490367 GCGCCCAGCCGCCCGCGCCGGGG + Exonic
1105964530 13:25372324-25372346 GCCCCGCGCCGCCCCCGCCCCGG - Intronic
1106340267 13:28820316-28820338 GCCCGCCCACGCCCGCGCCGCGG - Intergenic
1107545164 13:41428015-41428037 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1107545193 13:41428097-41428119 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1108389645 13:49936014-49936036 GCGCAGCGTCGCCGGCGCGGCGG + Intronic
1111220941 13:85205181-85205203 GCCCAGCGCCCCCCGCCCCGTGG + Intergenic
1112290785 13:98143017-98143039 GCGCCGCGCAGCCCGAGCAGCGG - Intronic
1113480408 13:110616006-110616028 GAGCGGCGGAGCCCGCGCGGTGG + Intronic
1114456090 14:22854473-22854495 GCGCGGTGGCTCCCGCGCTGAGG + Intergenic
1114518985 14:23321410-23321432 GAGCTGCGCCGGCCACGCCGAGG - Exonic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1115203186 14:30874865-30874887 GCGCGGGGCCTCCCGCACCCTGG + Intronic
1115851784 14:37595141-37595163 GCGCGGCGGCGGCGGCGGCGCGG + Intronic
1115855052 14:37622232-37622254 GCGCGGGGCGGGCCGGGCCGGGG - Intronic
1116817862 14:49599795-49599817 CCGCGGCGCTGCCGCCGCCGCGG - Intronic
1116817863 14:49599795-49599817 CCGCGGCGGCGGCAGCGCCGCGG + Intronic
1117037498 14:51743758-51743780 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1117037732 14:51744793-51744815 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
1117920792 14:60723768-60723790 GCGCGGCGGCGGCGGCGGCGTGG + Exonic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119330058 14:73787017-73787039 GCGCGGCCCAGCCCGAGCCCCGG + Intronic
1119410308 14:74426150-74426172 GCGCGGCGGCGGCGGCGGCGGGG - Intergenic
1121127559 14:91417841-91417863 GCGCGGGGCCGCCGAAGCCGCGG - Intronic
1121617008 14:95319973-95319995 GGTCGGGGCCGCCCCCGCCGCGG + Intergenic
1122066037 14:99175086-99175108 CCGCGCCGCCCCCCGCGCCCGGG + Exonic
1122582084 14:102777397-102777419 GCGGGGCGGCGGGCGCGCCGGGG + Intergenic
1122635385 14:103127293-103127315 GCGCGTGGCCGCCAGCCCCGAGG - Exonic
1122889071 14:104724303-104724325 GCTTGACGCCGCCTGCGCCGGGG - Intronic
1123036668 14:105474563-105474585 CCGCGGCGCCGCCCGCGCCCCGG - Intronic
1124790110 15:32718786-32718808 GCGGGGCGCGGCCCTGGCCGCGG + Intronic
1125603903 15:40929460-40929482 GCTGGGCGGCGACCGCGCCGAGG - Exonic
1125684982 15:41558851-41558873 GCGGGGCGCCGGCGGGGCCGCGG + Intronic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126407134 15:48332368-48332390 CCGGGGCTCCGCGCGCGCCGCGG + Exonic
1127789892 15:62390452-62390474 GCGCGGCGCCGGTCCGGCCGCGG - Intergenic
1127995567 15:64151684-64151706 GGGCGGAGCCGGCCGCCCCGGGG + Intergenic
1128016972 15:64356175-64356197 GCGCGGCCCCGCCCTCGTCCCGG + Exonic
1128280076 15:66387186-66387208 GCGCGGTCCCGTCAGCGCCGAGG - Exonic
1129162237 15:73753209-73753231 GCGCCGCGCCGCCCGCGCCCCGG + Intergenic
1130348015 15:83066896-83066918 TCGCGGCGCCGCCGCCGCTGGGG - Exonic
1130352998 15:83107785-83107807 GCGCGGCGGGGGTCGCGCCGAGG + Intronic
1131257352 15:90871467-90871489 GCGCGGGGCCGGACGCGCTGGGG + Intronic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132480581 16:164723-164745 CCGCGGCCCCGCCCGCCCCGCGG - Intronic
1132498861 16:275956-275978 GCGCGGCGCGGCGCGGGGCGGGG - Intronic
1132560225 16:590125-590147 GCCCCGCCCCGCCCGCGCCCGGG - Intronic
1132594111 16:740524-740546 GGGCGGCGGGGCCCGGGCCGGGG - Intronic
1132639411 16:970879-970901 CTGAGTCGCCGCCCGCGCCGGGG - Exonic
1132687218 16:1167354-1167376 GCGGGGTGGCGCCCGGGCCGCGG + Intronic
1132942410 16:2514582-2514604 CCGCGCCGCCGCCCGCGCACTGG - Intronic
1133188392 16:4116159-4116181 GTGCGCCGCCGCTCCCGCCGCGG + Exonic
1133188534 16:4116627-4116649 AAGCGGCGCCGCCCGGGGCGGGG - Intergenic
1134614890 16:15643263-15643285 GCGAGGCCCCGCCCCCCCCGGGG - Exonic
1136153599 16:28367905-28367927 GCCCGGTGCCGCCCGCGGCTTGG + Intergenic
1136209488 16:28747362-28747384 GCCCGGTGCCGCCCGCGGCTTGG - Intergenic
1136454026 16:30370287-30370309 GCGCGGCTCGGCGCGCGCCGGGG + Intergenic
1139496935 16:67326768-67326790 TCGCGGCGGCGCGCGCGCGGGGG + Intergenic
1139546612 16:67652812-67652834 GCGCGGAGCCGCGCGCGCTCGGG + Intronic
1139575999 16:67842456-67842478 GCGCGGCGCCGCCCGTCGAGGGG + Exonic
1139761470 16:69187489-69187511 GCGCGTCGCCGCCCGTGCGCCGG + Exonic
1139826699 16:69762588-69762610 GCGCGCCGCGGCCCGCGCGGGGG + Intronic
1140068079 16:71626712-71626734 GCGCTGCGACCTCCGCGCCGGGG + Intronic
1141831097 16:86510367-86510389 GCGCGGGGGCGGGCGCGCCGCGG + Intergenic
1142136151 16:88452945-88452967 GTTCGGCCCCGCCCGCGCCCCGG - Intergenic
1142518807 17:491198-491220 GCGGGGACCCGCTCGCGCCGGGG + Intergenic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1143099879 17:4499111-4499133 GAGCGGCGGCGCCGGCGCCGGGG + Exonic
1143676388 17:8436082-8436104 GCGCTGGGCCGGCGGCGCCGAGG + Intronic
1145236923 17:21214665-21214687 GGGCGGCGCCTCCCGCCCCTCGG - Intergenic
1145303657 17:21657298-21657320 GCGCGGCGCAGCCCTGGCGGAGG - Intergenic
1145346387 17:22044551-22044573 GCGCGGCGCAGCCCTGGCGGAGG + Intergenic
1146197371 17:30824825-30824847 TCCCAGCGCCGCCCGCCCCGCGG + Intergenic
1147150331 17:38510451-38510473 GCGCGCCGCCGCCTGGCCCGGGG + Exonic
1147720441 17:42536470-42536492 GCGCCGCGCCGCCGCCGCCCAGG - Exonic
1148698695 17:49575886-49575908 GAGCGGCGCCGCTGGAGCCGAGG + Exonic
1149614754 17:57988310-57988332 GGGCGGCGGCGGCCGGGCCGGGG - Intergenic
1149994616 17:61400093-61400115 GCGCGCCGCCGCCCGGGCCGGGG + Exonic
1150239946 17:63622921-63622943 GCGCGCCGCGGCCCGGGCGGGGG + Intronic
1150802208 17:68291338-68291360 GCGTGCTGCCGCCCGCGCCCCGG + Intronic
1152356503 17:79810132-79810154 GCGCGCCGCAGCCCGCTCGGCGG + Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152924395 17:83080541-83080563 GCCCAGCGCAGCGCGCGCCGCGG - Intronic
1153457268 18:5295390-5295412 GCGCGGCGGGGCCCGCGGCTCGG + Intronic
1153688239 18:7567369-7567391 GCGCGCCGCCGCCCGGGGCTGGG + Exonic
1153794472 18:8609676-8609698 GCCCGCCGCCGCCCGCCCCCCGG - Exonic
1153805482 18:8705905-8705927 GCAAAGCGCCGCCCTCGCCGGGG + Intronic
1153935241 18:9914648-9914670 GTCCGGTCCCGCCCGCGCCGCGG + Intronic
1154070533 18:11148713-11148735 GAGCGTCGCGGCCCGCGCCGAGG - Intronic
1154070719 18:11149319-11149341 TCGCAGCGCCGCCCGCGCACCGG - Intergenic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154174504 18:12076623-12076645 GCGCGGCCCCGCCGGCGTCCGGG + Intergenic
1154214743 18:12407901-12407923 GCGCGGCTCCGGGCGCGGCGTGG - Exonic
1154246286 18:12702601-12702623 GCGCGGCCCCGGCCGGGCCAGGG + Exonic
1154416370 18:14177972-14177994 GGGCTGCACCGCCCGCGGCGGGG + Intergenic
1157529517 18:48409452-48409474 GCGCCCCGCCTCCCGCGCCGCGG + Intronic
1158259051 18:55587935-55587957 GCTCCGCGCCTCCCGCGCCGCGG - Intronic
1160024787 18:75208787-75208809 GCGCGGCGCGGCGCGAGCCCGGG + Intronic
1160204794 18:76823137-76823159 GCGCGGCGCCGGCTGCCCCGGGG + Intronic
1160453040 18:78978803-78978825 GCGCGGCGACGACGGGGCCGGGG + Intergenic
1160455202 18:78994655-78994677 GGGCGGGGCTGCCCGCGCTGCGG - Exonic
1160499903 18:79396393-79396415 GGGGGGCGCGGCCCGGGCCGTGG - Intronic
1160668388 19:344391-344413 GCGCCGCGGGGCCCGGGCCGGGG + Intronic
1160788699 19:913050-913072 GCGGGGCGCGGCGGGCGCCGGGG - Intronic
1160912674 19:1482086-1482108 ACACGGCGGCGCCCGCGCTGAGG - Exonic
1160930758 19:1568446-1568468 GCCCGGCGCCGGCCCCGCCCCGG - Intergenic
1161072754 19:2270712-2270734 CCGCGGCACCGCCAGCACCGCGG - Intronic
1161175810 19:2841674-2841696 GTCCTGCGCCGCCCTCGCCGGGG - Intronic
1161175989 19:2842162-2842184 GGGCGTCTCCGCCCCCGCCGAGG - Intronic
1161279077 19:3435281-3435303 GCCCCGCGGCGCCCGCGCAGTGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162007181 19:7788327-7788349 GAGCAGCGCCGCGCGCTCCGTGG - Intergenic
1162027763 19:7904103-7904125 GCGGGGCGGGGCGCGCGCCGCGG + Intronic
1162778659 19:12995639-12995661 GCTCGGCCCCGCCGGCTCCGGGG - Exonic
1162948583 19:14057655-14057677 GGGCGGGGCCGGCCGCGCCCGGG + Intronic
1163557588 19:18001365-18001387 GGGCGGCGCCTACCGCGGCGGGG + Intronic
1165774360 19:38395998-38396020 GCGCGGCCCAGCGCGCGGCGGGG - Exonic
1165851457 19:38852226-38852248 GGGCGGCGCCGCGCGCGGCCGGG - Intronic
1165939827 19:39409609-39409631 GCGCGGCGCCCCCGACGCCCGGG - Intergenic
1166105969 19:40598212-40598234 TCCCGGCCCCGCCCCCGCCGCGG - Intronic
1166121737 19:40690804-40690826 GCGGGGCGGTGGCCGCGCCGGGG - Intronic
1167258124 19:48443087-48443109 GCCCGCCGGCGCCCGCGCGGTGG + Exonic
1168315152 19:55481868-55481890 GCACGGCGCCGCCCCCGCCCCGG + Exonic
926090010 2:10043548-10043570 GCGCCGCGAGGGCCGCGCCGGGG + Exonic
927215854 2:20667449-20667471 CCGCGGCGCGGCGCGCGGCGCGG - Exonic
927652345 2:24920203-24920225 GCGCGGCGCCGGCGGCTCCGGGG + Intergenic
929537505 2:42792747-42792769 GCGCGGCGGCGGCAGCGCTGGGG + Intergenic
929604972 2:43227604-43227626 GCGCGGCGCCCCCACTGCCGGGG - Intergenic
930011420 2:46941034-46941056 CCCCGCCGCCGCCCCCGCCGCGG - Intronic
932352526 2:71043768-71043790 GGCGGGCGCCGCCCGCGCTGCGG + Intergenic
932790986 2:74654392-74654414 GCGCGGCCCCGCCCGGGTCCCGG + Exonic
933886139 2:86720502-86720524 GCGGGGCTCCCCCGGCGCCGCGG + Exonic
933924042 2:87076204-87076226 GCGGGGCTCCCCCGGCGCCGCGG - Intergenic
934566976 2:95346595-95346617 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
935149032 2:100417413-100417435 GCGCGGCGCCCCCAGGGCCAGGG - Exonic
937261222 2:120587679-120587701 GCGCGGCCCGGCCCGCGGGGCGG - Intergenic
937284523 2:120741704-120741726 GAGCGGCGCCGACCGTGCCGCGG + Intronic
937997086 2:127702140-127702162 CCGCGGCGCCGGCCTCGCCAAGG + Exonic
942748757 2:179264768-179264790 GCGCGACCCCGCGCGCGCCCGGG + Exonic
943185165 2:184598312-184598334 GCGCGGCGCCGCTGCCGCAGAGG - Intergenic
944271279 2:197786690-197786712 GCGCGGCCCCGCCCGCCTGGCGG - Intronic
945241554 2:207681459-207681481 CCCCGCCGCCGCCCTCGCCGCGG + Intergenic
946865594 2:224039052-224039074 GGGCAGCGCCGGCCGCGCCCGGG + Intronic
947119169 2:226798871-226798893 CCACGCCGCCCCCCGCGCCGGGG + Exonic
947538537 2:230957546-230957568 GCCCAGCACCGCCGGCGCCGCGG - Intronic
947641124 2:231708355-231708377 GCGCAGCGCGGGACGCGCCGGGG + Intronic
947748643 2:232522040-232522062 GCGCGGCGCCGCCCGGGGCCTGG + Exonic
948115730 2:235493718-235493740 TCGCGGCGGCCCCCGCGCCCCGG - Intergenic
948468626 2:238163893-238163915 GCGCGGCGCCCGCGGCCCCGGGG - Exonic
948874666 2:240820250-240820272 GCGCGGGGCGGTCCGGGCCGGGG - Exonic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1168795904 20:610077-610099 GCGCGGCGCGGCCCGGGCCCCGG - Exonic
1169065595 20:2692870-2692892 GGGCGGCGGCGGCCGCGGCGGGG + Exonic
1170026071 20:11891005-11891027 GCGCGGGACCGCCCGGGCAGGGG + Intronic
1170890176 20:20369233-20369255 GCCCGCCGCCGCCCGCGCGCCGG + Exonic
1171034693 20:21705787-21705809 GCGCGCTGCCGCCCGCTCCAGGG - Exonic
1171555747 20:26081495-26081517 GCGCGGCGCAGCCCTGGCGGAGG + Intergenic
1171974879 20:31587988-31588010 GCGCGGCGAGTCCAGCGCCGAGG + Intergenic
1171977616 20:31605516-31605538 GCGCTGCGCCGGGGGCGCCGGGG + Exonic
1172064183 20:32207654-32207676 GCGCGGCCCGGCCCGCAGCGTGG - Exonic
1172118369 20:32584336-32584358 CCGCGCCGCTGCCCGGGCCGTGG - Intronic
1172274977 20:33674435-33674457 GCGCGTCGGCGCCGGCGCCAAGG - Intronic
1172359609 20:34303003-34303025 GCGCGGCGGCCCCGGCGTCGCGG + Intronic
1172408208 20:34704560-34704582 GCCCTGCGCCCCCCGCGCCCGGG + Intronic
1172951977 20:38728183-38728205 GCCCGGCTCCATCCGCGCCGTGG + Exonic
1173516241 20:43667259-43667281 GCGCGGCGCGGTCCGGGCCGGGG + Exonic
1173930224 20:46811600-46811622 GCGCGGCGCAGATGGCGCCGGGG + Intergenic
1174506948 20:51023115-51023137 GCGCGGCGCAGCAGCCGCCGAGG + Exonic
1174804609 20:53594225-53594247 GCGCGGCGCGTCCGGCGCTGGGG + Intronic
1175847131 20:62065066-62065088 GCGCGGCGGCGCCCACGAAGGGG + Exonic
1175997225 20:62817262-62817284 GCGCGGAGTCGCCAGCGCCTCGG + Intronic
1176548360 21:8211521-8211543 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176567291 21:8394556-8394578 GCGCGGCGGCGGCGCCGCCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176856961 21:13981294-13981316 GGGCTGCACCGCCCGCGGCGGGG - Intergenic
1178457806 21:32771708-32771730 GCTCGGCGCTGCCGGGGCCGCGG - Exonic
1178513833 21:33229902-33229924 CCGCGCCGCCGCCGGCGCGGGGG - Intronic
1178513837 21:33229905-33229927 GCGCCGCGCCGCCGCCGGCGCGG - Intronic
1178992246 21:37366296-37366318 CCGCAGCCCCGCCCGCGCCGGGG - Intronic
1179615314 21:42579672-42579694 GCACAGGGCGGCCCGCGCCGTGG - Intronic
1179893690 21:44350251-44350273 GCTCGGAGCCGCCCGCGCCCCGG - Intronic
1179921700 21:44510871-44510893 CCCCGGCCCCGCCCCCGCCGAGG - Intronic
1179988035 21:44932087-44932109 GCGCGGAGCCTCCCCCGCCGCGG + Intergenic
1180014698 21:45074555-45074577 GGGCGGAGCCGCCGGCGGCGGGG + Intronic
1180101600 21:45590344-45590366 GCGCGCGGCCGCCCGCTCCCAGG + Intergenic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1181478067 22:23180757-23180779 GCGCGGGGCGGGGCGCGCCGGGG - Exonic
1181567980 22:23751233-23751255 GCGCGAAGCCGCCCGGGCCCCGG + Intergenic
1182576475 22:31276574-31276596 CCCCGCCGCCGCCCTCGCCGCGG + Intronic
1183441392 22:37825019-37825041 GCGCGGCGGCGGCCGAGGCGCGG + Exonic
1183535603 22:38398832-38398854 GCGCGGCGCGTCCGGCGCTGGGG + Intergenic
1183720187 22:39557900-39557922 GCCCGCCGCCCCCCGCGCCCCGG + Intergenic
1184037766 22:41926595-41926617 GCGCGGCGCCGGCAGCTGCGGGG - Intronic
1184046745 22:41976842-41976864 GCGCGGCGCCGAGCGAGCCGAGG + Exonic
1184523792 22:45009832-45009854 GCGCGGGGCTCCCGGCGCCGGGG - Intronic
1184562054 22:45269129-45269151 GCGCGGCACCGCCCCCTCCCCGG + Intergenic
1184681131 22:46072547-46072569 GCGCGGCGCCGGCGGCGGCCAGG + Intronic
1185278753 22:49961037-49961059 GCGCGGGGCCGGCGGGGCCGGGG + Intronic
1185409515 22:50674602-50674624 GGCCGGGGCCGCTCGCGCCGGGG - Intergenic
1185413503 22:50697775-50697797 GCGCGGTGCTGGCCGGGCCGGGG + Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
953657082 3:44862275-44862297 CCGCAGCGCCGCCCGCGGCCCGG - Intronic
954664783 3:52245953-52245975 GCGAGGCGTCGGCCGCCCCGGGG - Intronic
954669060 3:52278442-52278464 GCGCGGCGCCCGCCCCGCCTGGG - Exonic
954838898 3:53494530-53494552 GCGCGGCGCGGCGCGGGCCGTGG + Intergenic
956677936 3:71753428-71753450 CGGCGGCGGCGCCCGCGCTGGGG - Intronic
956678190 3:71754300-71754322 GCCCGGCGGCGCCCCCGCCGCGG - Exonic
958692115 3:97481555-97481577 GCGCGGCGCGTCCGGCGCTGGGG + Intronic
959539836 3:107525151-107525173 GCGCGGGGACGTCGGCGCCGGGG - Intronic
960577079 3:119240594-119240616 GCGCGGCGCCGCCTCTGCTGCGG - Exonic
961274430 3:125715906-125715928 GCGAGGCGCCCCCCGCGATGTGG + Intergenic
961277347 3:125738458-125738480 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
961277396 3:125738619-125738641 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961599884 3:128052392-128052414 GCGCGGCGCGGCGCGGGGCGGGG - Exonic
961827254 3:129605646-129605668 TGGCGTCGCCGCCGGCGCCGTGG + Exonic
961877030 3:130031049-130031071 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
962222469 3:133574515-133574537 GGGTGGCGCCGCCCGGGCCTTGG - Intronic
963236720 3:142963603-142963625 GCGCGCGGCCGCCCGCGCTGCGG + Exonic
964201223 3:154121388-154121410 GCGGGCCGGCGCCGGCGCCGCGG + Intronic
966362829 3:179148527-179148549 GGGCGGCGGCGGCGGCGCCGAGG - Exonic
966594202 3:181711784-181711806 CCGCGCCGCCGGCCGCGCGGGGG - Intergenic
968092809 3:195909102-195909124 GCGCGGCGAGGCCCGGGCCGGGG - Intronic
968965265 4:3766291-3766313 GCGCGGCCCCGCCCTCGGCCCGG - Intergenic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
968989308 4:3898239-3898261 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
969240372 4:5893105-5893127 GCGGGGCGTGGCGCGCGCCGGGG + Intergenic
969330807 4:6472580-6472602 GCGCTGCGCCGACCAAGCCGGGG + Intronic
969378921 4:6782204-6782226 GCACGGCCCCGCCCGCGGCCCGG - Intronic
969787925 4:9473699-9473721 GCCGGGCGCCCCCCGCGCTGCGG + Intergenic
969787955 4:9473784-9473806 GCGGGGCGCCCCCCGCGCTGCGG + Intergenic
969788182 4:9474461-9474483 GCGCGGCGCCCCCCGCGCTGCGG + Intergenic
969788356 4:9474969-9474991 GCGGGGCGGCCCCCGCGCTGTGG + Intergenic
971018961 4:22515753-22515775 GCGCGGCCCCGCCGGCGTCCGGG + Exonic
972396453 4:38663529-38663551 GCGCCGCGCCGCGCCGGCCGCGG + Intergenic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975870774 4:78776363-78776385 GGGCCCCGCCGCCCGCTCCGCGG - Exonic
979534220 4:121801337-121801359 GCGCGCCGCTGCTCGCCCCGAGG - Exonic
980130362 4:128811616-128811638 CAGCTGCGCCGCCCGGGCCGGGG + Intronic
980930412 4:139177932-139177954 GCGCGACGCCGGCCCCGCCCCGG + Intergenic
981093342 4:140755850-140755872 CTGCGGCGCCGCCCGCGGCCTGG - Intronic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
982745793 4:159103340-159103362 CCGCGGCGGCGCCGGCGCCGGGG + Intergenic
982745990 4:159104017-159104039 GCCCCGCGCCGCCGCCGCCGCGG + Intergenic
983656480 4:170089985-170090007 GCGCGGCGAGGCCCGCGGCGGGG - Intronic
983919811 4:173333827-173333849 CCGCGCCCCCGCCCGCGCCCCGG + Intronic
983938958 4:173522330-173522352 GCGAGGCTCCGGCCCCGCCGCGG + Intergenic
984462825 4:180058544-180058566 GCGGGGCGAACCCCGCGCCGCGG - Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
984778588 4:183504909-183504931 CCCCGGCGCCGGCCCCGCCGAGG + Intergenic
985064304 4:186105472-186105494 GCGCGGCCCAGACCCCGCCGGGG - Intronic
985696695 5:1344951-1344973 GCGCGCCACCGCCACCGCCGCGG + Exonic
986330770 5:6714481-6714503 GCGCGGGGCCGCGCGGCCCGGGG - Intergenic
988577765 5:32444028-32444050 GCCCGGCCCGGCCCGCGGCGGGG - Intronic
991435941 5:66596960-66596982 GAGCTGTGCCGCCCGCGCCCCGG + Exonic
992990509 5:82278415-82278437 GCGCGGCGCAGACAGCGGCGCGG - Exonic
993726924 5:91380098-91380120 GAGCGGCGGCGGCCGCGCCGTGG + Intronic
994353873 5:98774015-98774037 GGGCGGCGGCGCGGGCGCCGTGG - Exonic
995574309 5:113513634-113513656 GCGCAGCGGCGGCCGCGCTGAGG + Intergenic
996442966 5:123512515-123512537 TGGGGGCGCCGCCCGCGCCCGGG + Intronic
997177793 5:131797043-131797065 GCGCCCCGCCCCGCGCGCCGTGG - Intronic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998352999 5:141513321-141513343 ACCCGCCCCCGCCCGCGCCGGGG - Intergenic
998463273 5:142324652-142324674 GCGCCGTGCCGGCCGGGCCGAGG + Intronic
1002368455 5:178730672-178730694 GCCCGGCGCCGCTCACCCCGCGG + Exonic
1002638328 5:180618983-180619005 GCGGGGCGCCGCGGGCGGCGGGG - Intronic
1002638943 5:180621509-180621531 GCGCGTCCCCGCCCTCCCCGCGG + Intronic
1003049234 6:2765354-2765376 GCGAGGCGCCTCCGCCGCCGGGG + Intergenic
1003551724 6:7107373-7107395 GCGGGGAGTCGCCCGCGGCGAGG + Intergenic
1003624284 6:7727806-7727828 GCGCAGCCCTGCCCGCGGCGCGG - Intronic
1006477157 6:34263694-34263716 CCGCCGCGCCGCCCGCTCCGAGG + Intergenic
1007431486 6:41779822-41779844 GCCCGGCGCCGCCCGGGCCGCGG - Exonic
1007553473 6:42747002-42747024 GGGCGTCGCCGGCCGCGCTGGGG + Intronic
1007784261 6:44270962-44270984 GCGGGGCGCCGGCCGCGCTGCGG - Intronic
1013272499 6:108557876-108557898 ACGCGGCGGGGCCCGCGGCGCGG - Intergenic
1013507447 6:110814784-110814806 CCGCGGCGCAGCCCGGTCCGAGG - Intronic
1014205543 6:118651670-118651692 GCGCGGCGCCGCGCGGGGCGGGG + Intronic
1014798314 6:125749653-125749675 GCGCGGCTCCGGCGGCGGCGCGG - Exonic
1015149271 6:130019994-130020016 CGGCGGCGGCGGCCGCGCCGGGG + Intronic
1016597010 6:145814554-145814576 GGCCGGCGCCGTCCGCGCTGCGG - Intronic
1016923217 6:149317067-149317089 GCGCGGCGCCGCCGGCCGCCCGG + Intronic
1017324582 6:153130967-153130989 CCGCGCAGCCGCCCCCGCCGGGG + Intronic
1017324730 6:153131480-153131502 GCGCGGCGCCCACCGTGCGGAGG + Intergenic
1017662457 6:156687539-156687561 GCGCGGAGCGGGCGGCGCCGCGG + Intergenic
1017877531 6:158536870-158536892 GCGCGGCGCGGGCAGCGGCGGGG + Intronic
1018400447 6:163415025-163415047 GCGCGGTGCCGGCCGCCCCGGGG + Exonic
1019198342 6:170295529-170295551 GCGCAGAGCTGCCCGCGCCGGGG - Intronic
1019386577 7:760106-760128 GCGCGGCTCCTCCAGCTCCGAGG + Intronic
1019472877 7:1230425-1230447 CCGCGGCGCCGCCGCAGCCGAGG + Intergenic
1019795232 7:3043780-3043802 GAGGGGCGCCGCCCGCCCAGGGG + Exonic
1019828282 7:3301471-3301493 GCGCGGCGCCCCCCGGCCCGAGG - Exonic
1019828285 7:3301485-3301507 GCGCCGCGCCTCCCGCGGAGTGG + Exonic
1020238469 7:6374470-6374492 GAGCGGCGGCGCCGGCGCGGGGG + Intergenic
1020312148 7:6876347-6876369 GCGAGGCGCCCCCCGCGATGCGG - Intergenic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1022096269 7:27143353-27143375 GCGCGGCGCCCGCCGAGCCCAGG - Exonic
1022101669 7:27173001-27173023 GCGCGGCGCGGCCCACGCGGGGG - Intronic
1023937261 7:44748854-44748876 TCGCGCCGCCGCCCGCTCCGAGG - Intronic
1024043824 7:45574466-45574488 CGGCGCCGCCGCCCGCGCCCCGG + Intronic
1025281656 7:57629926-57629948 GCGCGGCGCAGCCCTGGCGGAGG - Intergenic
1025303074 7:57835589-57835611 GCGCGGCGCAGCCCTGGCGGAGG + Intergenic
1026000456 7:66556660-66556682 GCGCGGCGCGGCCCGCAGCCCGG + Intergenic
1026471325 7:70695385-70695407 GCGTGGCGCTGCCCGCTCCTGGG + Intronic
1027001770 7:74658612-74658634 GCGCGGCCCCGCCCCCGCGCCGG - Intronic
1027230065 7:76267465-76267487 GCACGGCGCAGCCCGCGGCGCGG - Intronic
1028762487 7:94510441-94510463 GCCCCGAGCCGCCCGCGCTGGGG + Intronic
1029079219 7:97959179-97959201 GCGAGGCGCCCCCCGCGATGTGG - Intergenic
1029425858 7:100493760-100493782 GCGCGCCACCGCCCGGACCGAGG + Exonic
1029640763 7:101817446-101817468 GCGCGGAGTCCCCGGCGCCGCGG + Intronic
1029715145 7:102321585-102321607 GCCCGGCCGCGCGCGCGCCGTGG + Exonic
1030138701 7:106284564-106284586 GCGCGGCGGCGGCGGCGCGGCGG - Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1031447643 7:121873692-121873714 CCGCGCGGCCGCCCGCTCCGTGG - Intronic
1032013567 7:128361649-128361671 CGGCGAAGCCGCCCGCGCCGGGG + Exonic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032525658 7:132576986-132577008 GCCCGCGGCCGGCCGCGCCGCGG + Exonic
1033186507 7:139231627-139231649 GGGCGGAGCCGCCGGCCCCGCGG + Exonic
1034264125 7:149773117-149773139 CGGCCGCTCCGCCCGCGCCGCGG + Exonic
1035717065 8:1763378-1763400 GCGCGGCGCGGCGGGCGCTGTGG - Intronic
1035747780 8:1974162-1974184 GGGCAGCGCTGCCCGCGGCGGGG + Intronic
1036788996 8:11705168-11705190 GGGCAGCGCGGCCCGCACCGTGG + Intronic
1036789478 8:11708611-11708633 GCGCGGCGACACCGGCGGCGGGG - Exonic
1037807530 8:22066896-22066918 GCGCGGCGCCGCCCCGGGCCGGG + Intronic
1037903826 8:22703770-22703792 GCCCCCCGCCGCCCGGGCCGCGG + Intergenic
1037903836 8:22703782-22703804 GAGCGGCGCCGCCCGCGGCCCGG - Intergenic
1038035512 8:23683003-23683025 CCGCGGCGCGGCCCGTCCCGCGG - Intergenic
1038041419 8:23727057-23727079 ACGCGGGGCCGCCGGCGCCAGGG + Intergenic
1039921557 8:41897089-41897111 GGGCGGCGCGCCCCGCGCCCGGG + Intergenic
1039936597 8:42051641-42051663 GGGCGGCGGCGCGCGGGCCGCGG + Intronic
1040471255 8:47737626-47737648 GCGCGGCGGCTCCGGCGACGTGG + Exonic
1042155561 8:65841531-65841553 GCGCGGCGCCCGCCCTGCCGCGG + Exonic
1043954319 8:86343018-86343040 GCCCGGCGCCGTCCGCCCCCGGG + Intronic
1044257524 8:90082808-90082830 GCCCGGCAGCGCCCGCGCCCAGG - Exonic
1045023565 8:98064738-98064760 TACCGGCGCCGCCCGCGCCCGGG + Intronic
1045510784 8:102810657-102810679 TCCCGGCGCAGCCCGAGCCGTGG + Intergenic
1047024506 8:120811594-120811616 GCTGCGCGCCGCCCGCGCCCGGG + Exonic
1048980715 8:139702344-139702366 GCGCAGCCCAGCCCGCGCCGGGG + Intronic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1049638974 8:143705745-143705767 GCGCGGCGCCGCTCTAGCCCTGG + Intronic
1049707440 8:144049406-144049428 GCTGGGCGCCGCCCGCGCTCTGG + Intergenic
1049762199 8:144336653-144336675 GCCCGGCGCCGCCGCCCCCGGGG - Intergenic
1049844117 8:144791884-144791906 GCGCGCCGCGGCCCGGGTCGTGG + Exonic
1049854445 8:144852743-144852765 GCGCGGCGTCGCCCGTTCCGGGG + Intronic
1049867885 8:144950656-144950678 GCGCGGCTCCGCCCCCGCCCGGG + Intronic
1053381189 9:37650826-37650848 GCGCCGCGACCCCCGCCCCGGGG - Intronic
1053381223 9:37650942-37650964 GGGCTCCGCCTCCCGCGCCGAGG - Intronic
1053835345 9:42129340-42129362 GCGCGGCGCCGCCCCAGGCACGG + Exonic
1054091014 9:60847303-60847325 GCGCGGCGCCGCCCCAGGCACGG + Intergenic
1054112425 9:61122859-61122881 GCGCGGCGCCGCCCCAGGCACGG + Intergenic
1054595280 9:67059270-67059292 GCGCGGCGCCGCCCCAGGCACGG - Intergenic
1054765029 9:69036014-69036036 GGGAGGCGCCGCGCACGCCGGGG + Intronic
1056864792 9:90219875-90219897 GCGAGGCGCCCCCCGCGATGCGG + Intergenic
1057259662 9:93576655-93576677 GCGGGGCGCAGGCGGCGCCGCGG - Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057934022 9:99221804-99221826 GCTCAGCGCCGCCCACGCCCAGG + Exonic
1058412313 9:104747632-104747654 CCGCCGCGCCTCCCGCGCCGGGG + Intergenic
1059354434 9:113687928-113687950 GCGCGGTGCCTCGCGCTCCGGGG + Intergenic
1060106779 9:120877437-120877459 GCCCGCCCCCGCCCGCCCCGCGG + Intronic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060945779 9:127568788-127568810 GCGCCGCGCCACGCGCGCCCAGG - Intronic
1060952598 9:127613108-127613130 CCGCGGCGCGGCCCGGGGCGGGG - Intronic
1061075741 9:128340542-128340564 GCGCTGCGCCGCCGGCTCTGTGG + Intergenic
1061095808 9:128456326-128456348 CCGCGGGGTCGACCGCGCCGGGG - Intronic
1061726118 9:132582839-132582861 GGGCGGGGCTGCCCGCGCGGTGG - Exonic
1061802817 9:133121358-133121380 CCGCGGCCCCGCCCTCGCCGAGG + Intronic
1061863432 9:133479248-133479270 ACGCGGTGCCGGCCGCGCCCGGG - Intergenic
1061975939 9:134068089-134068111 CCGCGGCCGGGCCCGCGCCGGGG + Intronic
1062341417 9:136095316-136095338 CCGCCGCCCCGCCCCCGCCGCGG - Intergenic
1062408670 9:136410453-136410475 CCCCGGCTCCGCCCGTGCCGCGG + Exonic
1062499522 9:136846282-136846304 GCGTGGCGGCGCCAGCGCGGGGG - Exonic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062659168 9:137619267-137619289 GCGCGGCGCGGGCCGGGCGGCGG + Intronic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185610828 X:1392806-1392828 CCGCGGTGCCCTCCGCGCCGGGG + Intergenic
1186888618 X:13938693-13938715 GCGCGGCTCCGCCTGCACTGGGG + Intergenic
1187225825 X:17375093-17375115 GCGCTGCGCCCCCCTCGCCCCGG + Intergenic
1189534512 X:41923174-41923196 CGGCCCCGCCGCCCGCGCCGGGG - Intronic
1189534688 X:41923791-41923813 GCGGGGCGCCGGCCGCGTCACGG + Intergenic
1192762254 X:74105513-74105535 GCGCGGCGCCTCGAGCGCAGCGG + Intergenic