ID: 1032306824

View in Genome Browser
Species Human (GRCh38)
Location 7:130741871-130741893
Sequence TCTTATAAGCAGAAATAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032306824_1032306825 -4 Left 1032306824 7:130741871-130741893 CCTTCTTATTTCTGCTTATAAGA No data
Right 1032306825 7:130741890-130741912 AAGAACCCTTCTGATTGCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032306824 Original CRISPR TCTTATAAGCAGAAATAAGA AGG (reversed) Intergenic
No off target data available for this crispr