ID: 1032311591

View in Genome Browser
Species Human (GRCh38)
Location 7:130792435-130792457
Sequence ATGTATGTGCAGAGGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032311591_1032311596 23 Left 1032311591 7:130792435-130792457 CCCACAGACCTCTGCACATACAT No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311591_1032311595 -9 Left 1032311591 7:130792435-130792457 CCCACAGACCTCTGCACATACAT No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032311591 Original CRISPR ATGTATGTGCAGAGGTCTGT GGG (reversed) Intergenic
No off target data available for this crispr