ID: 1032311595

View in Genome Browser
Species Human (GRCh38)
Location 7:130792449-130792471
Sequence CACATACATCTTTTCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032311589_1032311595 -3 Left 1032311589 7:130792429-130792451 CCTCTCCCCACAGACCTCTGCAC No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311591_1032311595 -9 Left 1032311591 7:130792435-130792457 CCCACAGACCTCTGCACATACAT No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311588_1032311595 -2 Left 1032311588 7:130792428-130792450 CCCTCTCCCCACAGACCTCTGCA No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311592_1032311595 -10 Left 1032311592 7:130792436-130792458 CCACAGACCTCTGCACATACATC No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311590_1032311595 -8 Left 1032311590 7:130792434-130792456 CCCCACAGACCTCTGCACATACA No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311586_1032311595 5 Left 1032311586 7:130792421-130792443 CCCTCAACCCTCTCCCCACAGAC No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data
1032311587_1032311595 4 Left 1032311587 7:130792422-130792444 CCTCAACCCTCTCCCCACAGACC No data
Right 1032311595 7:130792449-130792471 CACATACATCTTTTCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032311595 Original CRISPR CACATACATCTTTTCAAGGC AGG Intergenic
No off target data available for this crispr