ID: 1032311596

View in Genome Browser
Species Human (GRCh38)
Location 7:130792481-130792503
Sequence AAAATACAGATAACTAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032311592_1032311596 22 Left 1032311592 7:130792436-130792458 CCACAGACCTCTGCACATACATC No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311588_1032311596 30 Left 1032311588 7:130792428-130792450 CCCTCTCCCCACAGACCTCTGCA No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311589_1032311596 29 Left 1032311589 7:130792429-130792451 CCTCTCCCCACAGACCTCTGCAC No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311590_1032311596 24 Left 1032311590 7:130792434-130792456 CCCCACAGACCTCTGCACATACA No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311591_1032311596 23 Left 1032311591 7:130792435-130792457 CCCACAGACCTCTGCACATACAT No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data
1032311593_1032311596 15 Left 1032311593 7:130792443-130792465 CCTCTGCACATACATCTTTTCAA No data
Right 1032311596 7:130792481-130792503 AAAATACAGATAACTAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032311596 Original CRISPR AAAATACAGATAACTAAATA TGG Intergenic
No off target data available for this crispr