ID: 1032318650

View in Genome Browser
Species Human (GRCh38)
Location 7:130864771-130864793
Sequence CAGGGGGAATGAAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032318638_1032318650 30 Left 1032318638 7:130864718-130864740 CCAGTAGTGGAGAGTAGAATGGT No data
Right 1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032318650 Original CRISPR CAGGGGGAATGAAGAGAAGT TGG Intergenic
No off target data available for this crispr