ID: 1032322199

View in Genome Browser
Species Human (GRCh38)
Location 7:130895652-130895674
Sequence CTGTAGGACTGCTCGGAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032322194_1032322199 -6 Left 1032322194 7:130895635-130895657 CCTGTGGAAGGGGCCGACTGTAG No data
Right 1032322199 7:130895652-130895674 CTGTAGGACTGCTCGGAATTGGG No data
1032322193_1032322199 -5 Left 1032322193 7:130895634-130895656 CCCTGTGGAAGGGGCCGACTGTA No data
Right 1032322199 7:130895652-130895674 CTGTAGGACTGCTCGGAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032322199 Original CRISPR CTGTAGGACTGCTCGGAATT GGG Intergenic
No off target data available for this crispr