ID: 1032322248

View in Genome Browser
Species Human (GRCh38)
Location 7:130896077-130896099
Sequence GGGCCGTCCAGGGCCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032322248_1032322252 -8 Left 1032322248 7:130896077-130896099 CCTGTGGAGGCCCTGGACGGCCC No data
Right 1032322252 7:130896092-130896114 GACGGCCCGGCTAAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032322248 Original CRISPR GGGCCGTCCAGGGCCTCCAC AGG (reversed) Intergenic
No off target data available for this crispr