ID: 1032322378

View in Genome Browser
Species Human (GRCh38)
Location 7:130897133-130897155
Sequence TGTGCGAGGCTGCCACCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032322378_1032322385 30 Left 1032322378 7:130897133-130897155 CCACGAGGTGGCAGCCTCGCACA No data
Right 1032322385 7:130897186-130897208 CACCGGCGCTCACCACCACGTGG No data
1032322378_1032322381 13 Left 1032322378 7:130897133-130897155 CCACGAGGTGGCAGCCTCGCACA No data
Right 1032322381 7:130897169-130897191 AAAATGCGTCCCATCCTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032322378 Original CRISPR TGTGCGAGGCTGCCACCTCG TGG (reversed) Intergenic
No off target data available for this crispr