ID: 1032322394

View in Genome Browser
Species Human (GRCh38)
Location 7:130897222-130897244
Sequence AAAAATTCCACCACGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032322387_1032322394 11 Left 1032322387 7:130897188-130897210 CCGGCGCTCACCACCACGTGGGC No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data
1032322389_1032322394 -2 Left 1032322389 7:130897201-130897223 CCACGTGGGCAGAGCCACTAAAA No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data
1032322388_1032322394 1 Left 1032322388 7:130897198-130897220 CCACCACGTGGGCAGAGCCACTA No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data
1032322383_1032322394 20 Left 1032322383 7:130897179-130897201 CCATCCTCACCGGCGCTCACCAC No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data
1032322382_1032322394 21 Left 1032322382 7:130897178-130897200 CCCATCCTCACCGGCGCTCACCA No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data
1032322384_1032322394 16 Left 1032322384 7:130897183-130897205 CCTCACCGGCGCTCACCACCACG No data
Right 1032322394 7:130897222-130897244 AAAAATTCCACCACGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032322394 Original CRISPR AAAAATTCCACCACGGGGAC AGG Intergenic
No off target data available for this crispr