ID: 1032327557

View in Genome Browser
Species Human (GRCh38)
Location 7:130945526-130945548
Sequence AACCTCAGGTGACAGTTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032327557_1032327564 26 Left 1032327557 7:130945526-130945548 CCTTACAACTGTCACCTGAGGTT No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data
1032327557_1032327559 7 Left 1032327557 7:130945526-130945548 CCTTACAACTGTCACCTGAGGTT No data
Right 1032327559 7:130945556-130945578 CTCTCCAACTAGCCAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032327557 Original CRISPR AACCTCAGGTGACAGTTGTA AGG (reversed) Intergenic
No off target data available for this crispr