ID: 1032327558

View in Genome Browser
Species Human (GRCh38)
Location 7:130945540-130945562
Sequence TGGAGAGTTACTCGAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032327558_1032327559 -7 Left 1032327558 7:130945540-130945562 CCTGAGGTTCGAGTAACTCTCCA No data
Right 1032327559 7:130945556-130945578 CTCTCCAACTAGCCAAGCCCTGG No data
1032327558_1032327566 30 Left 1032327558 7:130945540-130945562 CCTGAGGTTCGAGTAACTCTCCA No data
Right 1032327566 7:130945593-130945615 CATGGAAAAGTCAAACAGTCAGG No data
1032327558_1032327564 12 Left 1032327558 7:130945540-130945562 CCTGAGGTTCGAGTAACTCTCCA No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032327558 Original CRISPR TGGAGAGTTACTCGAACCTC AGG (reversed) Intergenic
No off target data available for this crispr