ID: 1032327560

View in Genome Browser
Species Human (GRCh38)
Location 7:130945560-130945582
Sequence GTAGCCAGGGCTTGGCTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032327560_1032327566 10 Left 1032327560 7:130945560-130945582 CCAACTAGCCAAGCCCTGGCTAC No data
Right 1032327566 7:130945593-130945615 CATGGAAAAGTCAAACAGTCAGG No data
1032327560_1032327564 -8 Left 1032327560 7:130945560-130945582 CCAACTAGCCAAGCCCTGGCTAC No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032327560 Original CRISPR GTAGCCAGGGCTTGGCTAGT TGG (reversed) Intergenic
No off target data available for this crispr