ID: 1032327564

View in Genome Browser
Species Human (GRCh38)
Location 7:130945575-130945597
Sequence CTGGCTACTTATCCTAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032327558_1032327564 12 Left 1032327558 7:130945540-130945562 CCTGAGGTTCGAGTAACTCTCCA No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data
1032327560_1032327564 -8 Left 1032327560 7:130945560-130945582 CCAACTAGCCAAGCCCTGGCTAC No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data
1032327557_1032327564 26 Left 1032327557 7:130945526-130945548 CCTTACAACTGTCACCTGAGGTT No data
Right 1032327564 7:130945575-130945597 CTGGCTACTTATCCTAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032327564 Original CRISPR CTGGCTACTTATCCTAATCA TGG Intergenic
No off target data available for this crispr