ID: 1032328744

View in Genome Browser
Species Human (GRCh38)
Location 7:130957321-130957343
Sequence GCCACCCTGAGCCCTCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032328744_1032328745 -9 Left 1032328744 7:130957321-130957343 CCAGCAAGAGGGCTCAGGGTGGC No data
Right 1032328745 7:130957335-130957357 CAGGGTGGCTCTGTGTACCCAGG No data
1032328744_1032328747 8 Left 1032328744 7:130957321-130957343 CCAGCAAGAGGGCTCAGGGTGGC No data
Right 1032328747 7:130957352-130957374 CCCAGGCTGAAGCCTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032328744 Original CRISPR GCCACCCTGAGCCCTCTTGC TGG (reversed) Intergenic
No off target data available for this crispr