ID: 1032329031

View in Genome Browser
Species Human (GRCh38)
Location 7:130960238-130960260
Sequence AGAGGAAATTATGTTGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032329031_1032329034 -2 Left 1032329031 7:130960238-130960260 CCATATTCAACATAATTTCCTCT No data
Right 1032329034 7:130960259-130960281 CTTTTTGAGTTCAGGATGATTGG No data
1032329031_1032329036 23 Left 1032329031 7:130960238-130960260 CCATATTCAACATAATTTCCTCT No data
Right 1032329036 7:130960284-130960306 ACTCCACATAGAACATGGAGTGG No data
1032329031_1032329032 -10 Left 1032329031 7:130960238-130960260 CCATATTCAACATAATTTCCTCT No data
Right 1032329032 7:130960251-130960273 AATTTCCTCTTTTTGAGTTCAGG No data
1032329031_1032329035 18 Left 1032329031 7:130960238-130960260 CCATATTCAACATAATTTCCTCT No data
Right 1032329035 7:130960279-130960301 TGGTTACTCCACATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032329031 Original CRISPR AGAGGAAATTATGTTGAATA TGG (reversed) Intergenic
No off target data available for this crispr