ID: 1032329033

View in Genome Browser
Species Human (GRCh38)
Location 7:130960256-130960278
Sequence ATCATCCTGAACTCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032329033_1032329036 5 Left 1032329033 7:130960256-130960278 CCTCTTTTTGAGTTCAGGATGAT No data
Right 1032329036 7:130960284-130960306 ACTCCACATAGAACATGGAGTGG No data
1032329033_1032329035 0 Left 1032329033 7:130960256-130960278 CCTCTTTTTGAGTTCAGGATGAT No data
Right 1032329035 7:130960279-130960301 TGGTTACTCCACATAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032329033 Original CRISPR ATCATCCTGAACTCAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr