ID: 1032329475

View in Genome Browser
Species Human (GRCh38)
Location 7:130964301-130964323
Sequence CATTTCCCATTTTAGAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032329475_1032329476 -4 Left 1032329475 7:130964301-130964323 CCTCAGCTCTAAAATGGGAAATG No data
Right 1032329476 7:130964320-130964342 AATGAATTTAAAGTGCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032329475 Original CRISPR CATTTCCCATTTTAGAGCTG AGG (reversed) Intergenic
No off target data available for this crispr