ID: 1032332175

View in Genome Browser
Species Human (GRCh38)
Location 7:130990779-130990801
Sequence CAGCAGAGGGAGATGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032332175_1032332183 11 Left 1032332175 7:130990779-130990801 CCCTGCACCATCTCCCTCTGCTG No data
Right 1032332183 7:130990813-130990835 ACTGTCAGGTCTCTGAGGGCAGG No data
1032332175_1032332182 7 Left 1032332175 7:130990779-130990801 CCCTGCACCATCTCCCTCTGCTG No data
Right 1032332182 7:130990809-130990831 CTAGACTGTCAGGTCTCTGAGGG No data
1032332175_1032332181 6 Left 1032332175 7:130990779-130990801 CCCTGCACCATCTCCCTCTGCTG No data
Right 1032332181 7:130990808-130990830 TCTAGACTGTCAGGTCTCTGAGG No data
1032332175_1032332180 -3 Left 1032332175 7:130990779-130990801 CCCTGCACCATCTCCCTCTGCTG No data
Right 1032332180 7:130990799-130990821 CTGTAAATATCTAGACTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032332175 Original CRISPR CAGCAGAGGGAGATGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr