ID: 1032344610

View in Genome Browser
Species Human (GRCh38)
Location 7:131106926-131106948
Sequence ACTCTAGAGACGGGGACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344610_1032344617 5 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344617 7:131106954-131106976 AAGGCATCCTGCGTCCCTGCCGG No data
1032344610_1032344620 16 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344620 7:131106965-131106987 CGTCCCTGCCGGAGAAAAGAGGG No data
1032344610_1032344627 29 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344610_1032344625 22 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344625 7:131106971-131106993 TGCCGGAGAAAAGAGGGACGGGG No data
1032344610_1032344623 20 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344623 7:131106969-131106991 CCTGCCGGAGAAAAGAGGGACGG No data
1032344610_1032344619 15 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344619 7:131106964-131106986 GCGTCCCTGCCGGAGAAAAGAGG No data
1032344610_1032344624 21 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344624 7:131106970-131106992 CTGCCGGAGAAAAGAGGGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344610 Original CRISPR ACTCTAGAGACGGGGACCGG AGG (reversed) Intergenic