ID: 1032344616

View in Genome Browser
Species Human (GRCh38)
Location 7:131106952-131106974
Sequence GGCAGGGACGCAGGATGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344616_1032344629 17 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344616_1032344628 16 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344616_1032344623 -6 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344623 7:131106969-131106991 CCTGCCGGAGAAAAGAGGGACGG No data
1032344616_1032344624 -5 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344624 7:131106970-131106992 CTGCCGGAGAAAAGAGGGACGGG No data
1032344616_1032344620 -10 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344620 7:131106965-131106987 CGTCCCTGCCGGAGAAAAGAGGG No data
1032344616_1032344625 -4 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344625 7:131106971-131106993 TGCCGGAGAAAAGAGGGACGGGG No data
1032344616_1032344627 3 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344616 Original CRISPR GGCAGGGACGCAGGATGCCT TGG (reversed) Intergenic