ID: 1032344618

View in Genome Browser
Species Human (GRCh38)
Location 7:131106961-131106983
Sequence CTTTTCTCCGGCAGGGACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344618_1032344629 8 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344618_1032344627 -6 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344618_1032344634 26 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344618_1032344628 7 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344618 Original CRISPR CTTTTCTCCGGCAGGGACGC AGG (reversed) Intergenic