ID: 1032344626

View in Genome Browser
Species Human (GRCh38)
Location 7:131106973-131106995
Sequence GGCCCCGTCCCTCTTTTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344626_1032344634 14 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344626_1032344628 -5 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344626_1032344629 -4 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344626 Original CRISPR GGCCCCGTCCCTCTTTTCTC CGG (reversed) Intergenic