ID: 1032344627

View in Genome Browser
Species Human (GRCh38)
Location 7:131106978-131107000
Sequence GAAAAGAGGGACGGGGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344613_1032344627 20 Left 1032344613 7:131106935-131106957 CCCGTCTCTAGAGTGCACCAAGG No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344616_1032344627 3 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344611_1032344627 26 Left 1032344611 7:131106929-131106951 CCGGTCCCCGTCTCTAGAGTGCA No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344615_1032344627 19 Left 1032344615 7:131106936-131106958 CCGTCTCTAGAGTGCACCAAGGC No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344612_1032344627 21 Left 1032344612 7:131106934-131106956 CCCCGTCTCTAGAGTGCACCAAG No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344609_1032344627 30 Left 1032344609 7:131106925-131106947 CCCTCCGGTCCCCGTCTCTAGAG No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344618_1032344627 -6 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data
1032344610_1032344627 29 Left 1032344610 7:131106926-131106948 CCTCCGGTCCCCGTCTCTAGAGT No data
Right 1032344627 7:131106978-131107000 GAAAAGAGGGACGGGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344627 Original CRISPR GAAAAGAGGGACGGGGCCAG AGG Intergenic