ID: 1032344628

View in Genome Browser
Species Human (GRCh38)
Location 7:131106991-131107013
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344618_1032344628 7 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344622_1032344628 -1 Left 1032344622 7:131106969-131106991 CCTGCCGGAGAAAAGAGGGACGG No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344621_1032344628 0 Left 1032344621 7:131106968-131106990 CCCTGCCGGAGAAAAGAGGGACG No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344626_1032344628 -5 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data
1032344616_1032344628 16 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344628 7:131106991-131107013 GGGCCAGAGGCCCGAGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344628 Original CRISPR GGGCCAGAGGCCCGAGTTCC AGG Intergenic
No off target data available for this crispr