ID: 1032344629

View in Genome Browser
Species Human (GRCh38)
Location 7:131106992-131107014
Sequence GGCCAGAGGCCCGAGTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344616_1032344629 17 Left 1032344616 7:131106952-131106974 CCAAGGCATCCTGCGTCCCTGCC No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344626_1032344629 -4 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344618_1032344629 8 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344622_1032344629 0 Left 1032344622 7:131106969-131106991 CCTGCCGGAGAAAAGAGGGACGG No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data
1032344621_1032344629 1 Left 1032344621 7:131106968-131106990 CCCTGCCGGAGAAAAGAGGGACG No data
Right 1032344629 7:131106992-131107014 GGCCAGAGGCCCGAGTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344629 Original CRISPR GGCCAGAGGCCCGAGTTCCA GGG Intergenic