ID: 1032344634

View in Genome Browser
Species Human (GRCh38)
Location 7:131107010-131107032
Sequence CAGGGAGTTGCTGATTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344630_1032344634 -7 Left 1032344630 7:131106994-131107016 CCAGAGGCCCGAGTTCCAGGGAG No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344618_1032344634 26 Left 1032344618 7:131106961-131106983 CCTGCGTCCCTGCCGGAGAAAAG No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344622_1032344634 18 Left 1032344622 7:131106969-131106991 CCTGCCGGAGAAAAGAGGGACGG No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344621_1032344634 19 Left 1032344621 7:131106968-131106990 CCCTGCCGGAGAAAAGAGGGACG No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data
1032344626_1032344634 14 Left 1032344626 7:131106973-131106995 CCGGAGAAAAGAGGGACGGGGCC No data
Right 1032344634 7:131107010-131107032 CAGGGAGTTGCTGATTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344634 Original CRISPR CAGGGAGTTGCTGATTCCAG TGG Intergenic