ID: 1032344887

View in Genome Browser
Species Human (GRCh38)
Location 7:131108202-131108224
Sequence AACAGCAGCAGGACTGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032344879_1032344887 25 Left 1032344879 7:131108154-131108176 CCTCTCTATGGAAACTTAAAGGG No data
Right 1032344887 7:131108202-131108224 AACAGCAGCAGGACTGGCGGCGG No data
1032344882_1032344887 -1 Left 1032344882 7:131108180-131108202 CCCACGTGACTGCAGCAGCAACA No data
Right 1032344887 7:131108202-131108224 AACAGCAGCAGGACTGGCGGCGG No data
1032344883_1032344887 -2 Left 1032344883 7:131108181-131108203 CCACGTGACTGCAGCAGCAACAA No data
Right 1032344887 7:131108202-131108224 AACAGCAGCAGGACTGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032344887 Original CRISPR AACAGCAGCAGGACTGGCGG CGG Intergenic