ID: 1032345339

View in Genome Browser
Species Human (GRCh38)
Location 7:131110944-131110966
Sequence CCTCCCTTGCCCTTTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032345337_1032345339 -1 Left 1032345337 7:131110922-131110944 CCTGAAACTCTGAACAATTTCAC 0: 1
1: 0
2: 3
3: 16
4: 245
Right 1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG 0: 1
1: 0
2: 1
3: 33
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032345339 Original CRISPR CCTCCCTTGCCCTTTGCCAC AGG Intronic
900405704 1:2492072-2492094 CCTACCGTGCCCTGTGGCACCGG + Intronic
901056728 1:6451781-6451803 CTTCCCTGGCCCTAGGCCACCGG + Intronic
901921752 1:12541807-12541829 CCTCCCTCACTCTCTGCCACGGG + Intergenic
902089110 1:13888922-13888944 ACTCCCTTGCCCTCTGCCTCAGG + Intergenic
902336712 1:15758554-15758576 CCTCCCCTCCCCCTTGGCACAGG - Intronic
903287749 1:22287319-22287341 CCTCCCCTTCCCCTTGCCACAGG + Intergenic
903422115 1:23225450-23225472 CCTCCCTTCCCCTCGGCCACCGG - Intergenic
903472009 1:23593800-23593822 CCTCCCTCGGCCTTTCCCATGGG + Intronic
903570371 1:24300085-24300107 CCTCCCTAACCCTTAGCCTCAGG + Intergenic
905462191 1:38129181-38129203 CCTCATTTGCCCTTTGCCTGGGG + Intergenic
907300031 1:53481288-53481310 CCTCCCTTGCTCTGTGCCCCAGG - Intergenic
911747364 1:101454401-101454423 CCTCCCTTGCACAGTGCCGCTGG + Intergenic
912174960 1:107142896-107142918 CCTCCCTTTCTCTTTGGCAAAGG + Intronic
913232115 1:116748628-116748650 CCTCCCTTTCCCTTTGTCAAAGG - Intergenic
913972102 1:143423415-143423437 TCTCCCTTGCCCACTGGCACGGG - Intergenic
914066483 1:144249028-144249050 TCTCCCTTGCCCACTGGCACGGG - Intergenic
914112670 1:144717326-144717348 TCTCCCTTGCCCACTGGCACGGG + Intergenic
916056615 1:161072893-161072915 CCTGACTTGCCCTTTGCCCTTGG - Intronic
916641983 1:166739527-166739549 CCTCCCTGGCCCTTAACCCCTGG - Intergenic
916847958 1:168672667-168672689 CCTCCCATACCCATTGCCATTGG + Intergenic
919433174 1:197522824-197522846 CTTCCCTTGTGCTTTGCCAATGG - Intronic
920293457 1:204940591-204940613 TCTCCCTTCCCCTCTGCCTCTGG + Intronic
920303440 1:205003581-205003603 CCACCCTTACCCTTAGCCCCAGG - Intronic
920683876 1:208094367-208094389 CCTCTCTTGCCCTTCTCTACTGG - Intronic
921187398 1:212682477-212682499 TCTCCCTTGCACTTTCCCTCAGG + Intergenic
922180427 1:223228795-223228817 CCAGCCTTGTCCTTTTCCACTGG - Intronic
923017887 1:230140729-230140751 CCTCCCTTCCCCTTTTCCTCAGG + Intronic
923516033 1:234698693-234698715 CCTCCCTTGCCCTTTCACTTTGG + Intergenic
924204957 1:241702979-241703001 CCTCCCTTGCCCCTTGGGAATGG + Intronic
1066388412 10:34959982-34960004 CCTCACTTCCCCTTTCCCAAGGG - Intergenic
1067045039 10:42980722-42980744 CCACCCTTGCCCTGTGGCCCTGG - Intergenic
1067046156 10:42986239-42986261 CCTCACTTCCCCTTGGCCAGGGG - Intergenic
1067527291 10:47046443-47046465 CCTCCCTTCCCCTGTGCCCTGGG + Intergenic
1069868977 10:71521631-71521653 CCTCCCCTACCCTCTCCCACGGG - Intronic
1070315731 10:75310532-75310554 CCTCACTTAGCCTTTGCTACTGG - Intergenic
1070368260 10:75757226-75757248 CCTCCCTTCCCCATTCCCAGGGG + Intronic
1070683035 10:78462417-78462439 CCTCCCTCCCCGTTTCCCACAGG - Intergenic
1070789561 10:79181208-79181230 CCTCCCAGGCCCCTTCCCACTGG - Intronic
1072553623 10:96497650-96497672 CCTCCCCTGCCCCTCACCACAGG + Intronic
1072764096 10:98082055-98082077 CCTCCCTTGCCCTTGTCCTCGGG - Intergenic
1072987029 10:100149824-100149846 CCTCCTTGCCCCTCTGCCACAGG + Intergenic
1074097058 10:110323123-110323145 CCTCCTTGGGCCTTTGCCTCAGG - Intergenic
1074416356 10:113270331-113270353 TCTCCCTTCCCCTCAGCCACTGG - Intergenic
1074546532 10:114405307-114405329 CATCCTTTGCCTTTTGCCACCGG + Intergenic
1075021443 10:118955643-118955665 CCTCCCATGCCCTCTTCCACAGG + Intergenic
1076228860 10:128803359-128803381 CCTCCCTTTACCTTTACCTCTGG + Intergenic
1076574324 10:131453787-131453809 CCGCCCCTGCCCTGTGCCCCGGG + Intergenic
1076590036 10:131576636-131576658 CCTCCCTGGCCCTTGGTCCCAGG - Intergenic
1077204563 11:1336377-1336399 CCTCCCCTGCCCTCTCCCACCGG + Intergenic
1079129228 11:17737847-17737869 CCTCCCTAGCCCTCTACCCCTGG - Intronic
1080638570 11:34144752-34144774 CCTCCCCTGCCCAGAGCCACTGG + Intronic
1081852166 11:46281386-46281408 CATCCCTTCCCCTTAGCCAGAGG - Intronic
1083332374 11:61904882-61904904 CCTCGCTTGCCCTCCCCCACAGG - Exonic
1083844342 11:65322098-65322120 GCTCCCTGTCCCTTTGCCCCAGG + Exonic
1084956126 11:72692615-72692637 GCCCCCTTGCCCGTTGGCACTGG - Intronic
1085297673 11:75440056-75440078 CCTCCCTTGCCCTTCCCCAGTGG - Intronic
1085659321 11:78349009-78349031 CTTCCTTTGCCCTTAGCCCCAGG - Intronic
1085690619 11:78660987-78661009 CCTTCCTTGCCGTGTGGCACTGG + Intronic
1087142300 11:94776609-94776631 CCTCCCTGGCACGTGGCCACAGG - Intronic
1087228005 11:95625865-95625887 CCTGCCTTGGCCTTCACCACTGG - Intergenic
1089096969 11:115927410-115927432 CCTCCCTTGCCCCCTTCCATGGG + Intergenic
1089131358 11:116214859-116214881 CTTCTCTTGCCCTTTCCCATTGG + Intergenic
1089367215 11:117928279-117928301 CCTCCCTTGCCCTCTGCTCTGGG - Intronic
1089755194 11:120681215-120681237 CCTCCCTGGCCCCTTACCCCAGG - Intronic
1091268946 11:134292310-134292332 CCTCCCTTTCCCGTGTCCACTGG + Intronic
1091413841 12:262960-262982 CCTCCCCTCCCCTCGGCCACTGG + Intergenic
1091766499 12:3123446-3123468 CCTCCCTTGCCCTTGGCCTGAGG + Intronic
1092061479 12:5554761-5554783 CCTCCCTATCCCTTTTCGACGGG - Intronic
1092148093 12:6228666-6228688 CCTCCTTGGCCCTTTGCCCATGG - Intronic
1093002303 12:14011158-14011180 GCTCCATTGCCCTTTGCCCCTGG - Intergenic
1093749528 12:22782201-22782223 CCTCCCATGCCCTCAGCTACTGG - Intergenic
1095598020 12:43981018-43981040 CTGCCCTCGCCCTTTGCCCCAGG + Intronic
1095957768 12:47816701-47816723 CCACCCCTGCCCCTTGCCCCAGG + Intronic
1096738818 12:53676964-53676986 CCTGCCCTGCCCTTTGGAACAGG + Intronic
1096780793 12:53991002-53991024 CCTCCCGGGCCCATTGCCATGGG + Intronic
1097323767 12:58252948-58252970 TCTCTCTTGCCTTTTGACACTGG - Intergenic
1098150445 12:67541028-67541050 CCTACCCTGCCCTCAGCCACAGG + Intergenic
1098496284 12:71139333-71139355 CCTGTCTTGCCCTTTGCTTCTGG + Intronic
1098805614 12:75017151-75017173 CCTCCATTGCCATCTGCCTCTGG + Intergenic
1101318146 12:103648776-103648798 CCTTCCTTGCCATTTTCCTCTGG - Exonic
1102042650 12:109810532-109810554 CCTCCCTTCCTCTTCGCCAGGGG + Intronic
1102397988 12:112603841-112603863 CATCCCTTTCCCTTTGTCAGAGG - Intronic
1102861377 12:116339258-116339280 CCTCCCTGGCCCTTTGGTTCTGG - Intergenic
1103187395 12:118971051-118971073 CCTCCCTTTCGCCTTGCCCCTGG - Intergenic
1104085949 12:125474299-125474321 CTTCCCTTTCCTTTTTCCACAGG + Intronic
1104133138 12:125913791-125913813 CCTCCCTGACCCCCTGCCACAGG + Intergenic
1106580512 13:31014159-31014181 CCTCCTTTGCTGTTTGCCTCAGG + Intergenic
1106917675 13:34532413-34532435 CCTCTCTTTGCCTCTGCCACTGG + Intergenic
1108848195 13:54699964-54699986 CCTGCCTTGCCCTTGGGCATGGG - Intergenic
1111344157 13:86926657-86926679 CTTCCCTTTCCCTTTTCCAGGGG + Intergenic
1112149522 13:96742192-96742214 ACTCCCCTGCCTCTTGCCACTGG - Intronic
1112630736 13:101158790-101158812 CCTCTCTTGCGCTTTGGCAAAGG + Intronic
1115480123 14:33852405-33852427 CCTTTCTTGCCCTGTGTCACTGG - Intergenic
1116855838 14:49951597-49951619 CCTGCCTGGACCTATGCCACAGG + Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1118892796 14:69923876-69923898 CCTGCCTTGGCCTGAGCCACTGG + Intronic
1120008914 14:79390957-79390979 CCTCTCTTGCCCTTTGCCTTTGG + Intronic
1122205995 14:100148334-100148356 CCTCCCGCCCCCTTTGCCACAGG + Intronic
1122652131 14:103231805-103231827 CCTCCCGTGACCTATGCCCCCGG - Intergenic
1122892847 14:104741064-104741086 CCTCCCCTGCCCCAGGCCACAGG + Intronic
1123105160 14:105837864-105837886 CCTCCCGTCACCTTTGTCACGGG - Intergenic
1124098567 15:26671785-26671807 CCTCCCCTCCCCAGTGCCACGGG + Intronic
1125125463 15:36214967-36214989 CCTCTCTTGCCCTTAGACATTGG + Intergenic
1125749868 15:42020884-42020906 CCTCCCTGGCCCTCAGCCTCTGG + Intronic
1127521505 15:59747222-59747244 CCTCCTTTGCTCTTGCCCACTGG + Intergenic
1128145254 15:65329303-65329325 CCCCCCTTCACCTTGGCCACGGG - Intronic
1128944519 15:71811708-71811730 CCTCCCATGCCCTGAGCCATGGG - Intronic
1129779832 15:78263473-78263495 CCTCCCTTGGCTTCTGCCAGGGG - Intergenic
1130686648 15:86043394-86043416 CCTCCATTGGCCTTTGTCTCAGG + Intergenic
1130831980 15:87610184-87610206 CTTCCCTTCCCCTTTGGCAGGGG + Intergenic
1132466280 16:78732-78754 CTTCCCTTCTCCTTTGCCCCAGG + Intronic
1132630101 16:913152-913174 CCTCCCTTCCCTTTAGCCAGGGG + Intronic
1132675014 16:1117965-1117987 CCTCCCTTGCTCTTGGCCTTGGG - Intergenic
1134071679 16:11264030-11264052 CCTCCCCTGACCCTTCCCACAGG - Intronic
1134909109 16:18008252-18008274 CTTCCCGTGGCCTTTCCCACAGG + Intergenic
1136687677 16:32004646-32004668 GCCCCCTTGCCCTTAGCCATCGG + Intergenic
1136788285 16:32948196-32948218 GCCCCCTTGCCCTTAGCCATCGG + Intergenic
1137011607 16:35327266-35327288 CACCCCATGCCCTCTGCCACTGG + Intergenic
1137903386 16:52293646-52293668 CTTTCCCTCCCCTTTGCCACTGG + Intergenic
1138329934 16:56205415-56205437 CCTCTCCTGCCCTTGCCCACTGG - Intronic
1140093971 16:71859759-71859781 CCTCCCCAGCCCACTGCCACAGG - Exonic
1140195044 16:72848641-72848663 CCTCCCACCCCCTATGCCACTGG + Intronic
1140816918 16:78629632-78629654 CCTACCCTGCTCCTTGCCACAGG + Intronic
1141763970 16:86046585-86046607 CCTCCCCTGCCACTTCCCACAGG - Intergenic
1141825202 16:86473718-86473740 ACTTCCTTGCCCTATGTCACTGG - Intergenic
1142479431 17:209187-209209 CCTCCCTTGCCCTCTTTCTCGGG - Intergenic
1142603570 17:1069730-1069752 CCTCCCCCGCCCTGTGCCACTGG + Intronic
1143377069 17:6473119-6473141 CCTCCCTCCCCCATTTCCACGGG + Intronic
1143881418 17:10032988-10033010 ATTCTCTTCCCCTTTGCCACAGG + Intronic
1144560589 17:16317673-16317695 CCTGCCCTGCCCTGAGCCACAGG + Intronic
1147148663 17:38500315-38500337 GCCCCCTTGCCCTTAGCCATCGG + Intronic
1147793756 17:43028535-43028557 CCTCCCTTGGCCGTGGCCATAGG + Exonic
1148027072 17:44595724-44595746 CCTCCCTGGGCATTTGGCACAGG - Intergenic
1148044967 17:44737946-44737968 CCTTCCTAGCCCTTTGCTTCTGG - Intronic
1148759331 17:49991380-49991402 CCTCCCTTGCCCCTTCCTCCAGG - Exonic
1149313651 17:55420515-55420537 CCTCCTTTACCCTTTGGGACTGG + Intronic
1150352746 17:64458601-64458623 CCTCTCTTGCCCTGAGCCAAGGG - Intronic
1150647410 17:66987796-66987818 GCTCCCTTGCCCTTGGCTTCTGG - Intronic
1151557061 17:74851979-74852001 CCTCCCTACCCCTATGCCCCGGG + Intronic
1151781844 17:76251882-76251904 CATGCATTGCCCTTTGTCACTGG - Intergenic
1152979634 18:264403-264425 CTGCCTTTGCCCTGTGCCACTGG - Intronic
1154266235 18:12881656-12881678 CCTCCCTTGTCCTCTTCCCCTGG + Intronic
1155285725 18:24287336-24287358 CCTCTCTTGACCTTGGCCATAGG - Intronic
1155627942 18:27858118-27858140 CCTCCCTGGCCACTGGCCACTGG + Intergenic
1156836707 18:41563718-41563740 CCTCCCGTGGCCCTAGCCACAGG + Intergenic
1157286699 18:46381917-46381939 ACTCCCTTGCTCTCTGGCACGGG + Intronic
1157352945 18:46907088-46907110 TCTCCATTGCCCTTTTCCATTGG - Intronic
1157589333 18:48826936-48826958 GCTCCCCTGCCCTTTGTCCCCGG - Intronic
1157979404 18:52363486-52363508 CCTCTCTTGCTCTTTGCTTCTGG + Intronic
1159395168 18:67846733-67846755 CCCCCCTTCCCCTTCCCCACTGG + Intergenic
1160579930 18:79877916-79877938 CCTCCACTGCCCTTGCCCACCGG + Intronic
1160694931 19:478950-478972 CCTCCCTTTCCCTTGGAGACAGG + Intergenic
1160824538 19:1073604-1073626 GCTCCCTTGCCCTGCCCCACAGG - Intronic
1160905267 19:1449062-1449084 CCTCCCTTGCCTTTGTCTACGGG + Intronic
1161394745 19:4038966-4038988 CCACCCATGCCCTTGGCCTCAGG + Exonic
1161488467 19:4548445-4548467 CCTCCCCTGCCCTGTCCCCCAGG - Exonic
1162922152 19:13909603-13909625 GGTCTCTTGCCCTTTGCCCCAGG + Intronic
1163774769 19:19211759-19211781 CCTCCCATTCTCTTTGCCCCAGG - Intergenic
1164690203 19:30205216-30205238 CCTCCCTTCACTTTTGACACAGG - Intergenic
1164794828 19:31017410-31017432 CCTCCCCAGCCCTTTGGAACTGG - Intergenic
1165044344 19:33092844-33092866 CATGCCCTGCCCTTGGCCACTGG + Intronic
1165114646 19:33521709-33521731 CCTCCCTCGCTCTTTCCCGCTGG - Intronic
1165329099 19:35131555-35131577 CCTCCCTGGCCTCTTGCCCCAGG - Exonic
1166103230 19:40583523-40583545 CCTCCCTTCCCCTCTCCCAGGGG - Intronic
1166123606 19:40700451-40700473 CCTCCCTTTCCTTCTGCCCCAGG - Exonic
1166258121 19:41620176-41620198 CCTCCCCAGCCCTTTTCTACTGG - Intronic
1167775206 19:51550145-51550167 CCTCCCCTGCCCTCAGCCCCAGG + Intergenic
925804658 2:7636299-7636321 GCTCACTTTCCATTTGCCACAGG - Intergenic
926001811 2:9339343-9339365 CCTACCCTGCCCTGTGACACTGG + Intronic
926307192 2:11646846-11646868 CCTCACTTACCCTTTGCCATGGG - Intergenic
927104221 2:19810122-19810144 CCAGCCTTGCCCTTTCCCAGGGG - Intergenic
927124783 2:20004118-20004140 CCTCCACTGCCCTTGGCAACAGG + Intronic
928178791 2:29053193-29053215 CCTCCCCTGCCCTTCCCCAGTGG + Exonic
929196639 2:39191732-39191754 CCAGCCCTGCCCTATGCCACAGG + Intronic
929423190 2:41816109-41816131 CTTCCCTTTCCCTTTTCAACTGG - Intergenic
930103027 2:47617773-47617795 CCTTGCTTTCCCTCTGCCACTGG - Intergenic
932006452 2:67932429-67932451 CCTCCTTTGCCTTCTGCCAAGGG + Intergenic
932427206 2:71645633-71645655 CCTCCCTAGGCCTGTGGCACAGG + Intronic
935358856 2:102230597-102230619 CCTGCCCTGCCCTCAGCCACTGG - Intronic
935705515 2:105853538-105853560 CCTCCCTTCCCTCTTGCCCCAGG + Intronic
936526332 2:113244230-113244252 CCTCCCTTGCCCCATGCTATGGG - Intronic
936904381 2:117520130-117520152 CCTTCTTTGCCTTATGCCACTGG + Intergenic
937066252 2:119020273-119020295 CTGCCCTGGCCCTTTGCCTCAGG + Intergenic
937525527 2:122764046-122764068 CCTCCCTTGCACAGTGCCATTGG - Intergenic
937624704 2:124030593-124030615 ACTCTCATGCCCTTTGCCATGGG - Intronic
938206750 2:129430797-129430819 CCTGCCTTCCCCTTTGGCATGGG - Intergenic
938670772 2:133584375-133584397 CCTGCCTGGCCCTTTGTCAGTGG - Intergenic
940204815 2:151191226-151191248 CTTCCCTAGCTCTTTGCAACAGG + Intergenic
940242532 2:151578620-151578642 CTTCCCTTGCCCTGTGGCCCTGG - Intronic
940892450 2:159048082-159048104 CTTTCCTTGCCCTGTGCCCCTGG - Intronic
946345635 2:219108099-219108121 CCTCCCCTGCCCTGTAACACAGG + Intronic
946629970 2:221656501-221656523 CCACCCTTGCCCTAAGCCATGGG - Intergenic
947636144 2:231681486-231681508 CCTCCGTTGCCCTCTGCCCCTGG - Intergenic
948214804 2:236220731-236220753 CCTCCACTGCCCCTTCCCACTGG + Intronic
948245548 2:236481186-236481208 CCTGCCTTTCCCTTTGTCTCTGG + Intronic
948816657 2:240513701-240513723 CCTGCCCTGCCCTCTGCCTCAGG - Intronic
948818057 2:240523601-240523623 CCTGCTTTGGCCTTTGGCACTGG - Intronic
1169082766 20:2807225-2807247 CCACCCCTGGCCCTTGCCACTGG + Intergenic
1170813904 20:19696921-19696943 CCCTCCTTCCCCATTGCCACTGG - Intronic
1171175487 20:23048790-23048812 CCTCCCTGGCCCAGTGCCCCTGG + Exonic
1172068112 20:32235846-32235868 CCTCCCTTGGCCTTTGATCCTGG + Exonic
1172226184 20:33306717-33306739 CCTCCCTTTGCCTCTGGCACTGG - Intronic
1172490242 20:35330694-35330716 CCTCTCTTGCCCTGTAGCACTGG - Intronic
1173804693 20:45916624-45916646 CCTCTCTTGCCCTTTGCATTCGG + Intergenic
1174206789 20:48846272-48846294 CCTCCCTTGCACTTCTCCCCTGG - Intergenic
1174525194 20:51164884-51164906 CCACCCTTGGACTTTGCCCCTGG - Intergenic
1174886735 20:54344065-54344087 CTGCCTTTGCCCTTTACCACTGG + Intergenic
1175281435 20:57806637-57806659 CTTCACTGCCCCTTTGCCACAGG + Intergenic
1175398949 20:58688896-58688918 CCTCCGTTGCCTTTTGCAACTGG - Intronic
1175421172 20:58834668-58834690 CCTCTCTCTCCCTCTGCCACAGG - Intergenic
1175715987 20:61254052-61254074 CTTCCCTGGCCCTGTGCCATGGG + Intronic
1176362499 21:6009703-6009725 TCTCCCTTGCTCTCTGCCAGTGG - Intergenic
1179576725 21:42312726-42312748 CCTCTCTTGCCCTTTGTCCTAGG - Intronic
1179761019 21:43528842-43528864 TCTCCCTTGCTCTCTGCCAGTGG + Intergenic
1179809888 21:43864351-43864373 CCTCCCTTGCACCTGGCCAGCGG - Intergenic
1179835006 21:44025286-44025308 CCAGACTTCCCCTTTGCCACTGG - Intronic
1180957644 22:19748059-19748081 TCACCCCTGCCCCTTGCCACTGG + Intergenic
1181344758 22:22210914-22210936 CCTCCCTTGGCCCATGCCATAGG - Intergenic
1182012130 22:27009924-27009946 CCTCCATGGCCCTGTGCCACGGG - Intergenic
1182524833 22:30908438-30908460 CCTCCCTTGCCCTCTGGGTCAGG - Intergenic
1183119890 22:35722242-35722264 CATCCCTTTCCCTTTACCAAAGG - Intronic
1183696951 22:39428881-39428903 CCTTCCTTTCCCTCTGCCTCTGG + Intronic
1183725033 22:39583865-39583887 CTTCCCTAGACCTTGGCCACTGG + Intronic
1184179344 22:42809538-42809560 CCTCCCCTGCCCCTGGCCCCTGG - Intronic
1184418018 22:44363424-44363446 CCTCCATGGCCCTGTGTCACTGG + Intergenic
1184660002 22:45961340-45961362 CCTCCCCTGCCACTTGCCAAAGG - Intronic
1185365882 22:50436525-50436547 CCTCCCTTGGCCTCTGCCTCAGG - Intronic
949609606 3:5690942-5690964 TCTCCCTTCCCCTTTTCCAGCGG - Intergenic
950709040 3:14802206-14802228 CCTCCTTCACCCTCTGCCACAGG + Intergenic
951246000 3:20342306-20342328 CCTGCCTTACCCTTTGCCTTAGG + Intergenic
952307173 3:32156537-32156559 CCTCTCTTGCCCTCTCCCACGGG - Intronic
952326747 3:32326923-32326945 ACTTCCTGGACCTTTGCCACTGG + Intronic
956034805 3:65079418-65079440 CTTCCCTTGCCCAGTGCCACTGG - Intergenic
956150695 3:66239134-66239156 TCTCCCTTGTCATTTGACACTGG + Intronic
956737129 3:72246604-72246626 GCTCCCTTGCCAGTTGACACGGG - Intergenic
956814421 3:72894909-72894931 CCTGCCCAGCCCATTGCCACTGG + Intronic
959017958 3:101157350-101157372 TCTCCCTTCCCCCTAGCCACAGG - Intergenic
959674011 3:109013907-109013929 CCTCCCTTGCTTTCTGCCATGGG + Intronic
961386557 3:126526314-126526336 CATCCCCTGCCCTTGGCCTCTGG + Intronic
962996509 3:140634059-140634081 CCTGCTTTGCCATTTGCCAGGGG - Intergenic
964980231 3:162669357-162669379 CCTCTGTTGCCATTTGCCTCTGG - Intergenic
965628443 3:170706105-170706127 CCTACCTTCCACTCTGCCACAGG + Intronic
965740973 3:171874269-171874291 CCTGCCTTGGCCTCTGCCACTGG - Intronic
966897629 3:184457642-184457664 CCTCCCTTGCCGTGTGCATCAGG + Intronic
968274141 3:197426936-197426958 CCTCCCATTCTCTTTCCCACAGG + Intergenic
968536792 4:1136187-1136209 CCTCTCTTCCCCTTGGCCTCTGG - Intergenic
968943539 4:3651915-3651937 CTTCCCCTGCCCTTCCCCACGGG + Intergenic
969674020 4:8605063-8605085 CCTCCCTTGGCCTTCTGCACAGG - Intronic
970870236 4:20808668-20808690 CCACCCTTGCCCTTTGTTAAAGG + Intronic
971329407 4:25670261-25670283 CCTCCCTTGGCCTTTTCCAGAGG - Intronic
971660322 4:29406325-29406347 CTTCTCCTGCCCTTGGCCACTGG - Intergenic
975037814 4:69706405-69706427 CCTCACTTCCCATTTGCTACTGG + Intergenic
975043901 4:69778894-69778916 CCTCCCTTCCCCTTAGCCCTTGG - Intronic
976137972 4:81959631-81959653 CCTGCCTTGCTCTGTGCCCCAGG + Intronic
977090682 4:92671570-92671592 CCTCCTTTGGCCTTTGACAGAGG + Intronic
979200587 4:117973306-117973328 CCTTCCATGCCTTTTTCCACAGG + Intergenic
979392858 4:120147485-120147507 CCTGCCTTCCCCTTTGATACTGG - Intergenic
986469303 5:8058516-8058538 CCTCACCTGCCCTTTCCCGCTGG + Intergenic
986702769 5:10427738-10427760 CCTTCTTTACCTTTTGCCACTGG + Intronic
986808034 5:11327190-11327212 CCTTCTTTGTCCTTTCCCACTGG - Intronic
988362828 5:30257162-30257184 GCTCCCTTGCCCTTTCCTCCAGG + Intergenic
989191285 5:38672068-38672090 CCTCCCTAGCTCTTGGCCTCTGG - Intergenic
995344204 5:111092695-111092717 TCTCCCTTCCCATTTACCACGGG + Intronic
997209895 5:132071071-132071093 CCTCCTAGGCCCTTGGCCACTGG + Intergenic
997258362 5:132446243-132446265 CCTCCCATGCCCTCAGCCTCAGG + Intronic
997616726 5:135251614-135251636 CCTTCCTTTCCATTTGCCCCAGG - Intronic
997734011 5:136200299-136200321 CCTCCCTCCCCCTCTGTCACTGG + Intergenic
998668355 5:144324919-144324941 CCTCCCTTCACCCCTGCCACAGG - Intronic
999133846 5:149304557-149304579 CCTCCCTTTCCTTCTGCCCCAGG - Intronic
999135227 5:149314219-149314241 CCTCACTTAGCCTTTGCCATTGG + Intronic
1000036843 5:157455271-157455293 CCTGCCCAGCCCTTCGCCACTGG - Intronic
1000206054 5:159059951-159059973 CCTGCCTTGACCTTTGAAACAGG + Intronic
1001569503 5:172720972-172720994 CCTCCCATTCCCTTGGCCACAGG - Intergenic
1001901304 5:175432533-175432555 CAGCCCTTGCCCTTTCCCCCAGG - Intergenic
1002876533 6:1215723-1215745 CTGCCCTTGCCCTTTGGCCCAGG - Intergenic
1002992499 6:2250837-2250859 CCTGCCTTGGCCTCTCCCACAGG + Intergenic
1003018500 6:2488643-2488665 CCTCCCTTGCTGACTGCCACTGG + Intergenic
1006016037 6:31081740-31081762 CCTCCCTTGCCCCTTTCCTTAGG + Intergenic
1006829537 6:36960593-36960615 CCTTCCTGGCCCTTTCCCTCTGG + Intronic
1006929376 6:37678542-37678564 CCTGCCATGCCCTCTGCCATCGG + Intronic
1007882805 6:45186028-45186050 CCTCCCTTCCTGTTTGCCTCTGG - Intronic
1008036750 6:46753443-46753465 CCTCCCCTGTGCATTGCCACAGG - Intronic
1008138379 6:47803271-47803293 CCTCCCTTCCTGCTTGCCACTGG + Intronic
1009024721 6:57984671-57984693 CCTCCCCTGCCCTCTCCCAAGGG - Intergenic
1009200298 6:60736143-60736165 CCTCCCCTGCCCTCTCCCAAGGG - Intergenic
1011001312 6:82591241-82591263 CCTCCATTGGCCTTTTACACTGG - Intergenic
1012548697 6:100448678-100448700 CCTCCCTATCCCTCTGCCTCAGG - Exonic
1013332200 6:109114667-109114689 CATCCCCTGCCCCTTGCCTCTGG - Intronic
1014794561 6:125709789-125709811 CCTCCCTTCCCCTGAGCCTCTGG - Intergenic
1015366465 6:132401820-132401842 CCTCCTTTTCCCTCTGCCTCTGG - Intergenic
1018156152 6:160987040-160987062 GCTCCCATGCCCTCTGCCAGAGG - Intergenic
1018533516 6:164794038-164794060 CCTCCCTCTCCCTTGGCCACAGG + Intergenic
1019327218 7:444409-444431 CCTCCCTTGACCTTTGAAACAGG + Intergenic
1020120958 7:5503079-5503101 CCTCCCTTCCCCTTTGTGGCTGG - Intronic
1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG + Intronic
1021759911 7:23893715-23893737 GCTCCCTTTCCCTTTTGCACAGG + Intergenic
1022322555 7:29300436-29300458 CCTTCCTGGGCCTTTGACACTGG + Intronic
1026661864 7:72309586-72309608 CCTCCCATGCCCTCCGCCAAGGG - Intronic
1026760297 7:73121600-73121622 TCTCTCTTTCCCTTGGCCACTGG - Intergenic
1027036639 7:74930421-74930443 TCTCTCTTTCCCTTGGCCACTGG - Intergenic
1027086924 7:75271038-75271060 TCTCTCTTTCCCTTGGCCACTGG + Intergenic
1028347255 7:89798322-89798344 CCTTGCCTCCCCTTTGCCACTGG - Intergenic
1028713278 7:93935644-93935666 CGGCCTTTGCCCTTGGCCACTGG + Intergenic
1029393223 7:100289036-100289058 TCTCTCTTTCCCTTGGCCACTGG + Intergenic
1029839549 7:103347623-103347645 CTTCCCTTTCCCTTCCCCACCGG - Exonic
1032345339 7:131110944-131110966 CCTCCCTTGCCCTTTGCCACAGG + Intronic
1034712347 7:153204809-153204831 CCTCCCCTGCCCTCTGCCAATGG + Intergenic
1035680140 8:1481946-1481968 CCTACCTGGCCCTTCTCCACGGG - Intergenic
1036432684 8:8704638-8704660 CTTCCCTTGCCATTTGGTACTGG + Intergenic
1038033165 8:23662423-23662445 CATCCCTGGTCCTTTGCCAGGGG + Intergenic
1038175925 8:25182308-25182330 CCTCCCTTGCCCCTTTACAATGG + Intergenic
1041912568 8:63104593-63104615 CTTCCTTTTCCCTTTCCCACTGG - Intergenic
1048255866 8:132904718-132904740 CCTCCCTTGCCTTTTGGAAGTGG - Intronic
1048596201 8:135868915-135868937 CCTGCGTTGCCCTTTTCCAGGGG + Intergenic
1048752744 8:137698253-137698275 CCTCCCTGGCCCTTTGGGATGGG - Intergenic
1049601659 8:143510584-143510606 CCTCCCTGGCCCTGTTCCCCAGG + Intronic
1049793439 8:144484133-144484155 ACTCCCAGGCCCTGTGCCACTGG + Intronic
1049796482 8:144499497-144499519 CCTCCCTTCCCCTTTGCTCCAGG + Intronic
1050287080 9:4114716-4114738 CTTCTCAAGCCCTTTGCCACTGG + Intronic
1053527115 9:38841466-38841488 GCTGCCTTGCCCTTTGCCCAAGG + Intergenic
1054199338 9:62065897-62065919 GCTGCCTTGCCCTTTGCCCAAGG + Intergenic
1054639015 9:67522460-67522482 GCTGCCTTGCCCTTTGCCCAAGG - Intergenic
1056659575 9:88534561-88534583 CCTCCCGCGCCCTCTCCCACTGG - Intergenic
1057002054 9:91519117-91519139 CTTCCCTGTTCCTTTGCCACTGG - Intergenic
1057942759 9:99299223-99299245 CCTCCCTTTCCCTGGGACACAGG - Intergenic
1058372398 9:104285009-104285031 CATCCCTTGCCCTTGGCCATGGG - Intergenic
1058985705 9:110207264-110207286 CCTCCCCTGCTCTTCCCCACTGG + Intronic
1059777717 9:117492577-117492599 CCCCTCTTGCCCTCTGACACTGG + Intergenic
1061679931 9:132237994-132238016 TCTCCCATGCCCTTGACCACTGG + Intronic
1061859956 9:133462909-133462931 CCTCACCAGCCCTGTGCCACTGG - Intronic
1185865560 X:3620730-3620752 CCTCTCTTGCCCTAAGCCAGCGG - Intronic
1188002323 X:24994494-24994516 GCTCCCAGGCCCTTTGGCACAGG + Intronic
1192180277 X:68911981-68912003 CCTCCCCAGACCTCTGCCACGGG + Intergenic
1192201295 X:69068381-69068403 TCTCCCTTGCCCTTTGACTCTGG - Intergenic
1192330191 X:70169249-70169271 CTCCCCTTGCCCTTTCTCACAGG - Intergenic
1195938592 X:110147976-110147998 CCTCCCTTGTCCCTTCCAACTGG + Intronic
1196496173 X:116327714-116327736 CCTCCCTGGCCCGTTTCCCCTGG + Intergenic
1197750115 X:129958056-129958078 GCTCCCTTGCCCGGTGCCCCTGG - Intergenic
1200136987 X:153879997-153880019 CCTCCCTGGCCCTTTCCCACCGG - Intronic
1200386680 X:155898768-155898790 CCTCCCCTACACTTTGCCCCAGG + Intronic
1200798142 Y:7360745-7360767 CCTCTCTTGCCCTAAGCCAGTGG + Intergenic