ID: 1032346077

View in Genome Browser
Species Human (GRCh38)
Location 7:131118106-131118128
Sequence CAATTAGGTCATAAGAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 153}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032346074_1032346077 13 Left 1032346074 7:131118070-131118092 CCTCATGAGCCTATTGATGATGA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1032346077 7:131118106-131118128 CAATTAGGTCATAAGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 153
1032346073_1032346077 14 Left 1032346073 7:131118069-131118091 CCCTCATGAGCCTATTGATGATG 0: 1
1: 0
2: 0
3: 13
4: 89
Right 1032346077 7:131118106-131118128 CAATTAGGTCATAAGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 153
1032346075_1032346077 4 Left 1032346075 7:131118079-131118101 CCTATTGATGATGAATGAGTTCT 0: 1
1: 2
2: 33
3: 212
4: 787
Right 1032346077 7:131118106-131118128 CAATTAGGTCATAAGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032346077 Original CRISPR CAATTAGGTCATAAGAGACC TGG Intronic
904356167 1:29941369-29941391 CTGTTAGGTCCTGAGAGACCAGG - Intergenic
906423968 1:45693873-45693895 GAAAAAGGACATAAGAGACCTGG + Exonic
911625525 1:100119678-100119700 CAGTTAGTTCATATGAGATCTGG + Intronic
913693328 1:121300395-121300417 CACTTAGTTCACAAGAGATCTGG - Intronic
915256312 1:154633076-154633098 CAAATATGTCAGAAGAGACAAGG - Intergenic
917714846 1:177723903-177723925 CAATAAGATCATAAGAGACAAGG + Intergenic
918552918 1:185764654-185764676 CATTAAGTTAATAAGAGACCAGG - Intronic
919710133 1:200718456-200718478 TAATTAGAACATAAGAGACAAGG + Intergenic
920480649 1:206318764-206318786 CACTTAGTTCACAAGAGATCTGG - Intronic
921079552 1:211727572-211727594 CTATTAGTTCACAAGAGAGCTGG + Intergenic
921781235 1:219167278-219167300 TAACTAGGTCATAAAAGACAAGG - Intergenic
922016789 1:221656353-221656375 CAGTTAGTTCATAGGAGATCTGG + Intergenic
923523430 1:234753968-234753990 CAATTAGATCATAAGGGAGGAGG + Intergenic
924791415 1:247253360-247253382 TAATCAGTTCATATGAGACCTGG + Intergenic
924825244 1:247531845-247531867 CAATGTGGCCGTAAGAGACCAGG + Exonic
1064058619 10:12118675-12118697 GAATTACGTCAGAAGAGGCCAGG - Intronic
1067811834 10:49434474-49434496 CAATTAATTCATAGGAGACAGGG + Intergenic
1067959727 10:50834529-50834551 AAATATGGTCATAAAAGACCAGG + Intronic
1068428617 10:56902373-56902395 CAATTAGGAAATAAAAGACACGG + Intergenic
1074653381 10:115552156-115552178 CATTTTGGTCTTAAGAGCCCTGG + Intronic
1075120957 10:119664438-119664460 CAATTAGGAAAGAAGAGCCCAGG - Intronic
1075576154 10:123578958-123578980 CAATGAGTTCACACGAGACCTGG + Intergenic
1077880214 11:6343265-6343287 GAATAAGGTAATAAGAGGCCGGG + Intergenic
1078106132 11:8359099-8359121 CAATAAGGTCAGGAAAGACCAGG + Intergenic
1079766271 11:24397072-24397094 CAAATAGGAAATAAGAGAACAGG + Intergenic
1081214165 11:40373715-40373737 CAGTTAGGTCATGCGAGAGCTGG + Intronic
1089122898 11:116152414-116152436 CTATTAGTTCATGAGAGATCTGG + Intergenic
1090123875 11:124064361-124064383 CAATTTGGTAATAACAGACAGGG - Intergenic
1092120280 12:6038791-6038813 GAGTTAGGTCATAAGAGAGCTGG + Intronic
1095331200 12:40966954-40966976 CAGTTTGATTATAAGAGACCCGG - Intronic
1095838964 12:46670834-46670856 CAATTAGTTCACATGAGACCTGG - Intergenic
1097883840 12:64709542-64709564 CAACTAGGTCCTAAAAGACATGG - Intergenic
1098593568 12:72243142-72243164 CAATCATGTCATCAAAGACCAGG - Intronic
1099742444 12:86657512-86657534 AAATTAGGTGATAAGAAAACCGG + Intronic
1099858229 12:88197186-88197208 TAAATAGGTCATAAGATACAAGG + Exonic
1100012311 12:89968214-89968236 TAATTAAGTCATAAGAGAAAAGG - Intergenic
1102385870 12:112509407-112509429 CAATTAGGTCATAAATAAACAGG - Exonic
1102765312 12:115427861-115427883 CAATTAGGTGAGAAAAGACTGGG + Intergenic
1105734710 13:23255682-23255704 CAGTTAGTTCACAAAAGACCTGG + Intronic
1105811259 13:23997772-23997794 CTATTAGTTCAGAAGAGAGCTGG - Intronic
1107354818 13:39555948-39555970 CAATTAGTTCACATGAGATCTGG + Intronic
1107651799 13:42552494-42552516 CATTTAGGACAAAAGAGTCCAGG + Intergenic
1108012706 13:46036299-46036321 CAATTCAGTAATAAGACACCTGG + Intronic
1108271351 13:48762749-48762771 CCCTTAGGTAATAAGAGACAGGG + Intergenic
1109336899 13:61005662-61005684 CTATTAGGTCACATGAGAGCTGG + Intergenic
1109535925 13:63719468-63719490 TAATTAGCTCATTAGAGACTCGG + Intergenic
1109540176 13:63766818-63766840 TAATTAGCTCATTAGAGACTCGG - Intergenic
1111068091 13:83123849-83123871 TAATTAGGTCAGAAGAGATTTGG + Intergenic
1111432591 13:88163069-88163091 GAATTAGTTAATGAGAGACCAGG - Intergenic
1113258306 13:108531866-108531888 CAATTAGGCCAGAAGAGTCAAGG + Intergenic
1115104690 14:29746140-29746162 GAATTAGGCCCTCAGAGACCTGG - Intronic
1116681518 14:47976368-47976390 CAGTTAGTTCATGTGAGACCTGG - Intergenic
1118679834 14:68229295-68229317 CAATTAGGCCAATAGTGACCAGG - Intronic
1121672701 14:95724973-95724995 CTATTAGTTAATATGAGACCTGG + Intergenic
1202888620 14_KI270722v1_random:133503-133525 CAATAAGGTCATCAGTGATCTGG - Intergenic
1125747560 15:42007488-42007510 CAATTAGGACAAGAGAGACCAGG + Intronic
1127017909 15:54708856-54708878 AAATTTGGTCATAAGAAACTTGG + Intergenic
1129130852 15:73493628-73493650 CAAATATTACATAAGAGACCTGG + Intronic
1130717583 15:86350857-86350879 CCATTAGGGCATAAGCCACCAGG - Intronic
1133542973 16:6773992-6774014 TAATTAGCTCCTCAGAGACCAGG + Intronic
1138307599 16:55991905-55991927 TAATTAGGTCATGAGAGAGGAGG + Intergenic
1141946403 16:87313326-87313348 CAATTAGATCAGAAGAGAAGAGG + Intronic
1142917542 17:3154180-3154202 CAATGCGGATATAAGAGACCAGG + Intergenic
1145023279 17:19448626-19448648 CCATTAGTTCACAAGAGAGCTGG - Intergenic
1148866345 17:50630743-50630765 CAATGAGGGCATCAGACACCAGG + Intergenic
1152300564 17:79493193-79493215 CAATTAGTTCATGTGAGATCTGG - Intronic
1154969300 18:21391530-21391552 TAATTAGGAGTTAAGAGACCTGG + Intronic
1157426752 18:47590857-47590879 CAATTAGCTCAAGAGAGATCTGG + Intergenic
1202664018 1_KI270708v1_random:100298-100320 CAATAAGGTCATCAGTGATCTGG - Intergenic
926356124 2:12042294-12042316 CACTTAGGGCAAAAGTGACCTGG + Intergenic
926661451 2:15471706-15471728 CAATTAGGTCATGAGAGTGGAGG + Intronic
932949357 2:76274411-76274433 CAGAGAGGTCATAAGAGATCAGG - Intergenic
935707847 2:105871860-105871882 CAATTAGGACCTTAGAGAGCGGG + Intronic
939396528 2:141637893-141637915 CAATTGGTTCACAAGAGATCTGG + Intronic
940561196 2:155299568-155299590 CAATTAGGGCAGAGGAGACATGG - Intergenic
942465079 2:176199105-176199127 CAATTAGATCATAAGCAATCAGG - Intergenic
943009351 2:182427804-182427826 CAATAATGTCATAAGATTCCAGG + Intronic
944850839 2:203717425-203717447 CCCTTAGGTCGAAAGAGACCAGG - Intronic
946100891 2:217321593-217321615 CAATTAAATCATAAGAAAGCAGG - Intronic
946858901 2:223981180-223981202 CAATTTGGTCATATTAGAGCTGG - Intronic
947185332 2:227449960-227449982 CTATTAGATCATCAAAGACCTGG - Intergenic
948511549 2:238469048-238469070 CATTTATGTCATGAGAGTCCTGG - Intergenic
1169511593 20:6269676-6269698 CAGTTAGTTCATGAGAGATCTGG + Intergenic
1169703669 20:8477736-8477758 CAATTAGTTCATGCGAGAGCTGG - Intronic
1170298937 20:14860553-14860575 CAATTAGGCAAACAGAGACCCGG - Intronic
1171430445 20:25080304-25080326 CAATTAGTTCACCAGAAACCTGG + Intronic
1172572151 20:35979166-35979188 CAAATAGGGCATAGGAGACTTGG - Intronic
1174679637 20:52393789-52393811 CAGTTAGTTCATGTGAGACCTGG + Intergenic
1178733639 21:35129434-35129456 CAATTAGGTCATGAAAGAGTAGG - Intronic
1179008246 21:37533170-37533192 GAATTAGCTGATAAGAGAACTGG + Intergenic
1184591806 22:45489627-45489649 GCATTAGGTCATAACAGAACTGG - Intergenic
949192166 3:1263369-1263391 AAATTAGGTTATAAGAGACTGGG - Intronic
951351786 3:21615186-21615208 TAATGAGCTCATATGAGACCTGG + Intronic
955692571 3:61605009-61605031 CCTTTAGGTCCGAAGAGACCTGG - Intronic
958728762 3:97937579-97937601 ACATTAGATCATAAAAGACCTGG + Intronic
963876474 3:150481072-150481094 CAATTATGAGATAAGACACCTGG - Intergenic
964646866 3:158967898-158967920 AAATTAGGGCAAAAGAGAGCAGG + Intronic
970424761 4:15935908-15935930 TAATGAGGTCAAAAGAGAACGGG - Exonic
971011021 4:22435136-22435158 CAAACAGGTCATAAGAGAAGAGG + Intronic
975121251 4:70730912-70730934 CAAATATGTCATCAGAGACTGGG - Intronic
981413271 4:144458137-144458159 GATTTGGGTCATAAGAGTCCAGG + Intergenic
981549786 4:145932275-145932297 CAATTTGCTTATAAGTGACCAGG + Intronic
981757233 4:148153815-148153837 CAAGTAAGTTGTAAGAGACCTGG - Intronic
981869253 4:149466963-149466985 TAATTAGGTCATGAGGGCCCCGG - Intergenic
983540124 4:168900119-168900141 CAATTAGTTCACATGAGATCTGG - Intronic
987291905 5:16516803-16516825 CAAAAAGATCATAAGAGGCCAGG + Intronic
988436003 5:31176520-31176542 CAATTAGATCATAAGTTCCCAGG + Intergenic
989703465 5:44298604-44298626 CAATTAGTTAATATGAGATCAGG - Intergenic
990075463 5:51841566-51841588 AAATTAGGTCATTACTGACCAGG + Intergenic
991711041 5:69408970-69408992 CAACTAGTTCATAAGAAACCAGG - Intronic
993033500 5:82731130-82731152 CAATTAAATCGTAAGAAACCAGG + Intergenic
994536758 5:101040602-101040624 CTATTAGTTCTTAAGAGAGCTGG - Intergenic
994944367 5:106366744-106366766 CCATTAGGAAATAAGAGAACAGG + Intergenic
997242806 5:132320440-132320462 TAATGAGGTCAGAAAAGACCTGG + Intronic
997601627 5:135142587-135142609 CTATTTGGTCAGAAGAGAACTGG - Intronic
998474350 5:142408036-142408058 CAATAAGGTCCTATGTGACCTGG - Intergenic
999703981 5:154254864-154254886 CAATAATGTCATCAGGGACCTGG + Intronic
1001713207 5:173794450-173794472 CAATTCGCTCAGAGGAGACCTGG + Intergenic
1002801297 6:523774-523796 CAATAAGGTCATTTGAGGCCAGG - Intronic
1005817021 6:29561771-29561793 CCATTAGCTCACAAGAGAGCTGG - Intronic
1009631414 6:66205741-66205763 CAATTATTTCATAAGAAAGCTGG + Intergenic
1010010150 6:71039748-71039770 CAAATATGTCATGAGAGACTTGG + Intergenic
1012243365 6:96898504-96898526 CCATTAGGTCAAATGAGAACGGG - Intergenic
1012877886 6:104751011-104751033 CATTTAGGGCCTTAGAGACCAGG - Intronic
1014935843 6:127383818-127383840 CAGTTAGTTCACAAGAGATCTGG - Intergenic
1015700720 6:136033426-136033448 GAATTAGGGCACAAGAGGCCGGG + Intronic
1016362035 6:143277679-143277701 TCATTGGGTCATAAGAGACCTGG - Intronic
1018415514 6:163599269-163599291 GAAATAGATCATGAGAGACCTGG + Intergenic
1018868815 6:167765976-167765998 CTATTAGTTCACACGAGACCTGG - Intergenic
1022023257 7:26421830-26421852 CAATTAATTCATGAGAGATCTGG + Intergenic
1022153360 7:27633311-27633333 CAAAGAGGTCAGGAGAGACCAGG + Intronic
1022211869 7:28218741-28218763 CAGTTAGCTCATAAGAGCTCTGG + Intergenic
1022381424 7:29863898-29863920 TAGTCAGGTCATAAGATACCAGG - Intronic
1024333672 7:48181274-48181296 CAATTGTGTCATTAGAGGCCTGG + Intronic
1030634341 7:111931546-111931568 CAATTAAGTTAAAAGAAACCAGG + Intronic
1032346077 7:131118106-131118128 CAATTAGGTCATAAGAGACCTGG + Intronic
1033537415 7:142324489-142324511 CAATTACTTAATATGAGACCCGG - Intergenic
1033776661 7:144619146-144619168 CTATTAGTTCACAAGAGAACTGG + Intronic
1033957985 7:146875716-146875738 GAATTAGGTCATAAAGGACCTGG - Intronic
1041253950 8:55962953-55962975 CTATTAGTTCACAAGAGAGCTGG - Intronic
1041686291 8:60647985-60648007 CCATTAGCTAATAAGAGGCCAGG + Intergenic
1044268380 8:90210108-90210130 CAATGAGGACATATGAGCCCAGG + Intergenic
1044997713 8:97853027-97853049 GAAAAAGGACATAAGAGACCTGG - Intergenic
1045012349 8:97969143-97969165 CAGTTAGTTCACATGAGACCTGG - Intronic
1048838633 8:138545546-138545568 CAATTAGGTCATGAGCACCCAGG + Intergenic
1049061742 8:140281378-140281400 CAAATAGCTCATAAGCAACCTGG - Intronic
1052530995 9:29683592-29683614 CAGTTAGTTCATGTGAGACCTGG + Intergenic
1053586195 9:39461754-39461776 CAGTGGGGTCATGAGAGACCTGG + Intergenic
1054580112 9:66903477-66903499 CAGTGGGGTCATGAGAGACCTGG - Exonic
1056479655 9:86988127-86988149 CAATTGGGACATCAGGGACCTGG + Intergenic
1056733745 9:89186537-89186559 CAATGAGGCCAGGAGAGACCAGG + Intergenic
1061194576 9:129100773-129100795 CAAATGGGTCAGAAGAGCCCAGG - Intronic
1189138037 X:38570125-38570147 GAATTAGGTCAGAAGACACATGG - Intronic
1191990757 X:67033081-67033103 GAATTCTGTCATAAGAGACTAGG - Intergenic
1192130274 X:68543230-68543252 CTATTAGTTCACATGAGACCTGG - Intergenic
1192169282 X:68844368-68844390 CAATAAGGTCACAAGAGCCTTGG - Intergenic
1194423954 X:93713770-93713792 CAGTTAGTTCACAAGAGATCTGG - Intergenic
1195716630 X:107825195-107825217 CAATTAGCTTATTAGGGACCTGG + Intergenic
1196298881 X:114031654-114031676 CTATTAGTTCACAAGAGATCTGG - Intergenic
1196777314 X:119351113-119351135 CAATGTGGTCAAAAGAAACCAGG + Intergenic
1197548381 X:127856380-127856402 AAATTAGGTTATATGAGACGGGG + Intergenic
1199791732 X:151161384-151161406 CAATCAGGTGATAAGACACAAGG - Intergenic
1201293198 Y:12441787-12441809 CAAGTAGTTCAGAAGAGACCAGG + Intergenic