ID: 1032356465

View in Genome Browser
Species Human (GRCh38)
Location 7:131215737-131215759
Sequence CTGTGATGATGGAGATACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032356463_1032356465 12 Left 1032356463 7:131215702-131215724 CCAAACAAGGAGAGTTTGTCTTT 0: 1
1: 0
2: 2
3: 16
4: 246
Right 1032356465 7:131215737-131215759 CTGTGATGATGGAGATACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032356465 Original CRISPR CTGTGATGATGGAGATACCA TGG Intronic
No off target data available for this crispr