ID: 1032357411

View in Genome Browser
Species Human (GRCh38)
Location 7:131223611-131223633
Sequence AGCATTTTAGAGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 1, 3: 67, 4: 532}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032357411_1032357415 2 Left 1032357411 7:131223611-131223633 CCATTCTCCATCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 67
4: 532
Right 1032357415 7:131223636-131223658 TCCTGGATCTTCTTCCCACAGGG 0: 1
1: 0
2: 0
3: 14
4: 217
1032357411_1032357414 1 Left 1032357411 7:131223611-131223633 CCATTCTCCATCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 67
4: 532
Right 1032357414 7:131223635-131223657 TTCCTGGATCTTCTTCCCACAGG No data
1032357411_1032357420 23 Left 1032357411 7:131223611-131223633 CCATTCTCCATCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 67
4: 532
Right 1032357420 7:131223657-131223679 GGCTCTCATGCTGAGCTGGCTGG No data
1032357411_1032357419 19 Left 1032357411 7:131223611-131223633 CCATTCTCCATCTCTAAAATGCT 0: 1
1: 0
2: 1
3: 67
4: 532
Right 1032357419 7:131223653-131223675 ACAGGGCTCTCATGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032357411 Original CRISPR AGCATTTTAGAGATGGAGAA TGG (reversed) Intronic
901328275 1:8383117-8383139 AGAATGTTAGAGATGGTGAATGG + Intronic
901471154 1:9457300-9457322 GGCATTTTGGAGATGAGGAACGG - Intergenic
902663161 1:17919643-17919665 ATCTTTCTTGAGATGGAGAATGG - Intergenic
903455049 1:23481813-23481835 AGAATCTTAGAGCAGGAGAAGGG - Intronic
903705050 1:25279566-25279588 CCCATTTTAGAGATGGGGAAAGG - Intronic
903722178 1:25413755-25413777 CCCATTTTAGAGAGGGGGAAAGG + Intronic
903985785 1:27227233-27227255 AGGATTTTAGAGAAGGAACAGGG + Intergenic
904411314 1:30326605-30326627 AGCATTTTACAGCTGCTGAATGG - Intergenic
904569890 1:31455490-31455512 AGAACTTAAGAGAGGGAGAAGGG + Intergenic
905115715 1:35638859-35638881 ATCATTTTATACTTGGAGAAAGG + Intronic
905492694 1:38356882-38356904 AGCATATGAGGGATGGGGAAAGG - Intergenic
905632551 1:39526750-39526772 AGCATGGTAGAGATGGTGGAGGG - Intergenic
906542817 1:46601238-46601260 TTCATTTTATAGATGGGGAAAGG - Intronic
906752012 1:48272940-48272962 AGCAATTTAAAAATGGACAAAGG - Intergenic
907318498 1:53588010-53588032 CCCATTTTATAGATGGGGAAAGG - Intronic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
907892976 1:58653252-58653274 AGAATTTTAAAGCTGGAAAAAGG - Intergenic
907941364 1:59090958-59090980 AGAATTTGAAAGTTGGAGAATGG + Intergenic
907961584 1:59288431-59288453 AGAAGTTAAGAGATGGAAAATGG + Intergenic
908034419 1:60036591-60036613 CCCATTTTACAGTTGGAGAATGG + Intronic
908443001 1:64173630-64173652 GCTATTTTACAGATGGAGAAAGG - Intronic
908446953 1:64207966-64207988 AGCAATTAAAAAATGGAGAAAGG + Intronic
908855853 1:68427242-68427264 ACCATTTTAAAGATGAGGAAAGG - Intergenic
909519537 1:76551180-76551202 ACCATTTTGGAGAAGAAGAAAGG - Intronic
909652243 1:77988504-77988526 AGAATGATAGAGATGGTGAAGGG - Intronic
910000370 1:82333892-82333914 AACATTCCAGAGGTGGAGAAAGG - Intergenic
910067892 1:83175267-83175289 AGAATTATAGACATAGAGAATGG + Intergenic
910185770 1:84538253-84538275 AGCATTTTCCAGATTAAGAATGG - Intergenic
910341281 1:86190916-86190938 AGCATTTAACAGATTTAGAAGGG - Intergenic
910550744 1:88471352-88471374 CCCATTTTAAAGATGGAGGAAGG - Intergenic
910722703 1:90304152-90304174 TGCATTCTAGAGTTGAAGAAGGG + Intergenic
911482326 1:98459760-98459782 ACCAGTTTAAAGCTGGAGAAAGG + Intergenic
911637654 1:100253116-100253138 AGCTTGTTAGAAATGCAGAATGG - Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911684571 1:100760176-100760198 CACATTTTAAAGATGGAGACAGG + Intergenic
912296642 1:108476174-108476196 AGCATCTTTAAGATCGAGAATGG - Intergenic
912364094 1:109118692-109118714 AGGATTTTGGAGTGGGAGAATGG + Intronic
913024756 1:114826390-114826412 AAAATTTTAGAAATGGAGGACGG + Intergenic
913070095 1:115290691-115290713 AGGCTTTAAGAGATAGAGAAGGG - Intronic
915092739 1:153437947-153437969 ACCATTCAAGAGATGGAGACTGG - Intronic
915196110 1:154191160-154191182 AGTATTAGAGAGATGGAGGATGG - Intronic
915930909 1:160060470-160060492 AGCATTTTAGATGAGGGGAAAGG + Intronic
915956795 1:160227177-160227199 AGCATTTAATGGGTGGAGAAAGG + Intronic
916501032 1:165387061-165387083 TTCTTTTTGGAGATGGAGAAAGG + Intergenic
916711870 1:167417961-167417983 AGGATTTTAGGGAAGGTGAAGGG - Exonic
916834885 1:168533292-168533314 AGGATTTTAGAGCTCGAGGATGG + Intergenic
917203201 1:172540099-172540121 TCCATTTTAAAGATGAAGAAAGG + Intronic
918776164 1:188633436-188633458 AACATTTAAGAGTTGGAAAATGG - Intergenic
919142947 1:193596152-193596174 AGCATTTAAGAGAGGGAGGCCGG + Intergenic
919476570 1:198038014-198038036 AGCATCTTTAAGATCGAGAATGG - Intergenic
919609235 1:199724900-199724922 TGCATCTTAGAGATGGACAGTGG + Intergenic
921191218 1:212710399-212710421 GGCATTTTTGAGAGAGAGAAGGG - Intergenic
921365969 1:214374130-214374152 TGCATTGTATAGATGTAGAAGGG - Intronic
921571958 1:216790340-216790362 TCCATTTTACAGATGGGGAATGG - Intronic
921589730 1:216989273-216989295 ATTTTTTTAGAGATGGAGATGGG - Intronic
922430988 1:225552772-225552794 AGCATTTTAGTGTGGGAAAAAGG - Intronic
922610771 1:226925464-226925486 AGCATTTAAGAACTGGAGAATGG + Intronic
922886739 1:229026132-229026154 AGCATTTTTCTTATGGAGAAAGG - Intergenic
923810824 1:237313469-237313491 TGCACTTTAAAGATGGAGGAAGG + Intronic
923889242 1:238193305-238193327 AGCATTGTAGGGAAGCAGAAAGG - Intergenic
923950048 1:238940084-238940106 AGCATATTTGTGATGGAGAGGGG - Intergenic
924835849 1:247646438-247646460 AGAGTTTTAGAGATGTTGAAGGG - Intergenic
1063005628 10:1967981-1968003 CTCATTTTATAAATGGAGAAAGG + Intergenic
1063242733 10:4188061-4188083 TGCACTTTAAAGTTGGAGAATGG - Intergenic
1063295719 10:4803724-4803746 AGGATTTTAGGGGTGCAGAAAGG + Intronic
1063426114 10:5951399-5951421 AGCATTTGGGAGATGGGGCATGG - Intronic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1065263559 10:23951782-23951804 AGCATTTTCCAAATGGAAAATGG + Intronic
1065309887 10:24404928-24404950 AAAATTATAGAGATGCAGAACGG + Intronic
1065375017 10:25030869-25030891 AGCATTTTTGAGGTGGAGGCAGG + Intronic
1065541610 10:26775141-26775163 AGCATTGTAGAGATGTGTAAAGG - Intronic
1066034110 10:31463589-31463611 AGGATGGTAGAGATGGAAAATGG - Intronic
1066066845 10:31767715-31767737 AGCACTTTGGAGATGGAGGCGGG - Intergenic
1067174434 10:43933475-43933497 AGCATATAAGTTATGGAGAAAGG - Intergenic
1067844595 10:49709787-49709809 AGCATTTACCAGGTGGAGAAGGG - Exonic
1069290180 10:66769418-66769440 AGCAAGTTAGACAGGGAGAATGG - Intronic
1069552095 10:69371473-69371495 AGAATTTTAGAGATGCAACAGGG - Intronic
1069927501 10:71860997-71861019 TGAAATTTAGAGAAGGAGAAAGG - Intergenic
1069982496 10:72262020-72262042 AGCATTTGGGAGGTGGAGATGGG - Intergenic
1070025237 10:72625954-72625976 AGCAATTTAGGGAAGGCGAAGGG - Intronic
1070484214 10:76914150-76914172 AGCATTTAAGGGTTGGGGAAAGG + Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070674093 10:78399988-78400010 GGAATCTTTGAGATGGAGAATGG + Intergenic
1071021479 10:81062081-81062103 AGAGTTCTAGAGATGAAGAATGG - Intergenic
1071116418 10:82226381-82226403 AACATTTTAGAAGTGCAGAAAGG + Intronic
1071725932 10:88198280-88198302 TGCATTTCAGAGGTGGAGAGAGG + Intergenic
1072305775 10:94105574-94105596 AGCATTTTAGAAAAGGATTAAGG - Intronic
1072736913 10:97885417-97885439 AGCATCTTAGATTTGTAGAATGG - Intronic
1074268798 10:111931910-111931932 AGCATTATACAGATGGACCATGG + Intergenic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075605430 10:123802027-123802049 AGCATCTCACAGATGGAGGAAGG + Intronic
1075863793 10:125699759-125699781 AGCATTCTGGAGATGGATAGTGG + Intergenic
1075926634 10:126256415-126256437 CCCATTTTACAGATGGAGACTGG - Intronic
1077346903 11:2064164-2064186 TGGAGTATAGAGATGGAGAATGG - Intergenic
1079547309 11:21647903-21647925 ACCATTTTGGAAATGGAGACAGG + Intergenic
1080302073 11:30795761-30795783 AGGATTATAGAGATGCAGTATGG - Intergenic
1081047380 11:38293342-38293364 TGCATATTATAGATGGAGAGAGG + Intergenic
1082744765 11:56949781-56949803 AGCAGTTTAGAGATGGGAAGAGG + Intergenic
1082832938 11:57632932-57632954 AGCATTTGAGAGAAGCAGGATGG + Intergenic
1083131700 11:60630867-60630889 AGCATTGTTGTGGTGGAGAAGGG + Intergenic
1084110346 11:67010366-67010388 AGCATGTTAGAGCTGGAGCCTGG - Intronic
1084757165 11:71246880-71246902 AGATTTTTAGAAATGGAAAAGGG - Intronic
1085444470 11:76591343-76591365 AAGAGTTTAGAGATGGATAATGG - Intergenic
1085894554 11:80622946-80622968 CCCATTTTATAGATGCAGAAAGG + Intergenic
1086034699 11:82402474-82402496 ACCATTTGATAGAGGGAGAAGGG - Intergenic
1086337727 11:85815638-85815660 TGCATTTTACAGATGAAGATAGG + Intergenic
1086556328 11:88115709-88115731 ACCATTTTATAGCTGGGGAAAGG - Intronic
1086642480 11:89177000-89177022 AGCATTGGAGAGAGAGAGAAAGG + Intergenic
1086961766 11:92985260-92985282 AGCATTTCAGAAGTGGACAAAGG - Intergenic
1088296986 11:108309580-108309602 AGCATTGTAGAGATGGGACATGG - Intronic
1088614715 11:111613896-111613918 AGCAAGTTAGAAATAGAGAAAGG + Intronic
1089124854 11:116169685-116169707 AGCTTTGCAGAGATGGAGAGGGG - Intergenic
1089334310 11:117712572-117712594 TGCATTTTAATGATGGGGAATGG + Intronic
1090339105 11:125999783-125999805 AGGATGTTAGAGAAGGAGAAGGG - Intronic
1090474284 11:127005258-127005280 ATCATTTAATAGATGAAGAAAGG - Intergenic
1091002063 11:131918036-131918058 TGCATTTAAAAGAGGGAGAAAGG - Intronic
1091685109 12:2555972-2555994 CGCAAGTTAGAGATGAAGAAAGG - Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093112227 12:15165872-15165894 AACCTTTTAGAGATGGAAGATGG + Intronic
1096050206 12:48600812-48600834 AGAATTTAGGAGAGGGAGAAGGG - Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096988159 12:55775738-55775760 AGTATTTTGGAGATGGAGGTGGG - Intronic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099199557 12:79659357-79659379 GGCATTTTAGACATCGGGAAAGG + Intronic
1099612215 12:84888592-84888614 TGCACTTTAGAGATTCAGAAGGG + Intronic
1100082583 12:90871281-90871303 AGCATTATAGAAATGGAAGATGG - Intergenic
1100406034 12:94273566-94273588 AGCATTTTAGGGATTTAGAGAGG - Intronic
1100896895 12:99192556-99192578 AGCATTTTAGAGATATAAAAGGG + Intronic
1101376342 12:104174397-104174419 CCCATTTTAGGGATGGAGAAAGG + Intergenic
1101584879 12:106076907-106076929 AACATTCTAGAGATGGATGATGG + Intronic
1101837162 12:108303729-108303751 TGCATTTTACAGACGGAGCAAGG + Intronic
1102329458 12:112016367-112016389 AACATTCTAGTGATGGTGAAGGG - Intronic
1102620941 12:114193934-114193956 AGCACTTTGAAGATGGAGGAAGG + Intergenic
1102968315 12:117146370-117146392 GGCATTTTTGGGGTGGAGAAGGG + Intronic
1102973414 12:117189563-117189585 CCCATTTTAGAGATGGGGAATGG - Intronic
1103322522 12:120100297-120100319 AGCCTTTCAGAGATGGAGCCAGG - Intronic
1105686280 13:22785518-22785540 AACATTTTAGAGGTGGGCAAGGG + Intergenic
1106442105 13:29784663-29784685 AAAATTATAGAGATGGAGAATGG + Intronic
1106653599 13:31718513-31718535 ACCATTTGAGAAAAGGAGAAAGG - Intergenic
1106776070 13:33011060-33011082 AGCATTCCAGAGATGGGGCAGGG + Intergenic
1107014660 13:35698331-35698353 AGCATTTAAGCGATGGAGGGAGG + Intergenic
1107071209 13:36271736-36271758 TGAACTTTAGAGATGCAGAAGGG + Intronic
1107422424 13:40260900-40260922 AGGATATTAGAGATGGTGGAAGG - Intergenic
1107439022 13:40407625-40407647 ACCATTTTATAGATGGGGACAGG + Intergenic
1107662280 13:42651028-42651050 AGCATTTTCTAGAGGGAAAAGGG + Intergenic
1108161803 13:47648051-47648073 AGAATTTTGGAAATGGATAAAGG + Intergenic
1108171713 13:47748778-47748800 AGCACCCTAGAGATGGATAAAGG + Intergenic
1108857700 13:54815433-54815455 AGTATTTTAGAGAGAGAGACAGG + Intergenic
1109045308 13:57403505-57403527 AGCATTTTTCAGAAGGAGGAAGG + Intergenic
1110280308 13:73685300-73685322 TGTATTATAGAGATGGAGAAAGG - Intergenic
1110541709 13:76713580-76713602 AGCATGGCAGAGATGCAGAAAGG + Intergenic
1111233865 13:85382284-85382306 ATTAATTTAGAGAGGGAGAAAGG - Intergenic
1111377837 13:87403725-87403747 AGCATGTTAGAACTGGAGAAGGG - Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111771179 13:92597786-92597808 AGTATTTTAGGCATAGAGAAGGG - Intronic
1113058170 13:106291465-106291487 AGCATTCCAGAGATGAACAATGG + Intergenic
1114391425 14:22312549-22312571 TGCATCTTAGAAATGGGGAAAGG + Intergenic
1114449525 14:22815835-22815857 AGCATTTAAGAAAGGGAGGAAGG + Intronic
1114740407 14:25091067-25091089 TCCATTTGGGAGATGGAGAATGG + Intergenic
1114811597 14:25906816-25906838 TGCATTTTAGAGATGTATGATGG + Intergenic
1114815764 14:25955945-25955967 AGCATTTTTGACAAGAAGAAGGG - Intergenic
1115331495 14:32202954-32202976 CGCATTTTGGAAATGGAAAAAGG - Intergenic
1115382960 14:32760386-32760408 TGCATTTTAGAGAAAGAGTATGG + Intronic
1116262050 14:42642985-42643007 AGAATTTTGGAGATGGATGATGG - Intergenic
1116472336 14:45300339-45300361 AGCATGTTAGAGAGACAGAAAGG + Intergenic
1116534611 14:46014899-46014921 AGCATCTTTAAGATCGAGAATGG + Intergenic
1117251137 14:53939852-53939874 AGATTTTAAGAGATAGAGAAAGG - Intergenic
1117865228 14:60141181-60141203 AGCATATTAGAAATGAGGAAAGG + Exonic
1117867717 14:60166649-60166671 AGCTTTTTAGAGAAGGATGAGGG - Intronic
1117976743 14:61305608-61305630 AGCAGTTTGGAGATGGCAAAAGG - Intronic
1118064487 14:62175994-62176016 AGCATTTTAGAGAATCAGAAAGG - Intergenic
1118165410 14:63331376-63331398 TGCATTTGAAGGATGGAGAAAGG + Intergenic
1118274753 14:64375811-64375833 CACATTTTAGAAATGGAAAAGGG + Intergenic
1118596499 14:67439484-67439506 AGCATATTAGAGCTTGAAAATGG + Intergenic
1118838832 14:69496092-69496114 CGCATTTTATAGAGGAAGAAAGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1119701468 14:76758533-76758555 TCCATTTTACAGATGAAGAAAGG - Intergenic
1120332982 14:83117154-83117176 AGCTTTTGAGAGAGGGAGAGAGG - Intergenic
1120357531 14:83453783-83453805 AGTAGTTCAGAGATGTAGAAGGG - Intergenic
1123457351 15:20438211-20438233 AGCATTTTCTACATGAAGAAAGG + Intergenic
1123464554 15:20505945-20505967 ACCACTTAAGAGATGGAGAGAGG + Intergenic
1123487354 15:20754131-20754153 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1123543845 15:21323185-21323207 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1123653560 15:22495096-22495118 ACCACTTAAGAGATGGAGAGAGG - Intergenic
1123660707 15:22562148-22562170 AGCATTTTCTACATGAAGAAAGG - Intergenic
1123743980 15:23303956-23303978 ACCACTTAAGAGATGGAGAGAGG - Intergenic
1124263501 15:28213361-28213383 AGCATTTTCTACATGAAGAAAGG + Intronic
1124275283 15:28321912-28321934 ACCACTTAAGAGATGGAGAGAGG + Intronic
1124307421 15:28589689-28589711 ACCACTTAAGAGATGGAGAGAGG - Intergenic
1124314507 15:28656385-28656407 AGCATTTTCTACATGAAGAAAGG - Intergenic
1125416614 15:39460503-39460525 TGCTTTTTAGAGATGGACAAAGG - Intergenic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128869127 15:71138981-71139003 CCCATTTTACAGATGAAGAAAGG + Intronic
1129670106 15:77602986-77603008 ATCATCTTATAGATGGGGAAAGG + Intergenic
1130437741 15:83918910-83918932 ACCATGGTAGAGATGGAGTATGG + Intronic
1130439351 15:83935759-83935781 AACATTTTAGAGATGAAATAGGG + Intronic
1131792294 15:95978287-95978309 GGCATTTTTGAGATGGAAAGGGG + Intergenic
1131920778 15:97326086-97326108 TGCATTTTAGAGATAGTTAATGG - Intergenic
1132193162 15:99886970-99886992 AGTATTTTAGGGATAGAGAAGGG + Intergenic
1132243371 15:100276878-100276900 AGGATTTGAGGGATTGAGAAAGG + Intronic
1202952161 15_KI270727v1_random:50312-50334 AGAATTTAAGAAGTGGAGAAGGG - Intergenic
1133651565 16:7817933-7817955 AGCATCTTTAAGATCGAGAACGG - Intergenic
1134307830 16:13049313-13049335 ATTATTTTACAGATGGGGAAAGG - Intronic
1134894110 16:17869338-17869360 TGCACTTTAAAGATGGAGGAAGG - Intergenic
1135227480 16:20674449-20674471 AGCATTTTGGGGGTGGAGAGGGG - Intronic
1135719544 16:24803556-24803578 AGCAGATTAGAGATGGCTAAAGG + Intronic
1136316245 16:29455980-29456002 AGCATCTTAGAGATGGGGATAGG - Intronic
1136430822 16:30195322-30195344 AGCATCTTAGAGATGGGGATAGG - Intronic
1138505494 16:57476342-57476364 CCCATTTTATAGATGGGGAAAGG + Intronic
1139097741 16:63725993-63726015 AGCATTGTTGCAATGGAGAAGGG - Intergenic
1140107049 16:71970179-71970201 AGCAATTTAGAGATGGAAAGAGG + Intronic
1140743423 16:77961458-77961480 TACATTTTAGAGATGGAGGTGGG + Intronic
1140972222 16:80024408-80024430 AACATTTTACAGATGGATAAAGG + Intergenic
1141495028 16:84403672-84403694 AGAATTCTGGAGATAGAGAATGG - Intronic
1142404351 16:89878971-89878993 AGCATTTTAGAGCTGATGCATGG + Intronic
1144057385 17:11555091-11555113 AGCAGCTTAGAGATGGCTAAGGG + Intronic
1144371206 17:14593582-14593604 GGCAATTTAGAAACGGAGAAAGG + Intergenic
1144692493 17:17277308-17277330 TGTATTCTAGAGCTGGAGAAAGG - Intronic
1145063665 17:19747842-19747864 TGCATTTTACAGATGAGGAAAGG + Intronic
1145893765 17:28438978-28439000 AGAATTATAGAGATGGATAGTGG - Intergenic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146602448 17:34229699-34229721 AGCATTTTTGAGGAGGAGAGGGG - Intergenic
1147049228 17:37778631-37778653 AGCTTGTTAGAAATGCAGAACGG + Intergenic
1147858229 17:43499383-43499405 AACATTTTAGGTATGGAAAAGGG + Intronic
1148822090 17:50365672-50365694 AGGATTAAAGGGATGGAGAAAGG + Intergenic
1148890397 17:50802942-50802964 AGCCTCCTAGAGAAGGAGAAAGG - Intergenic
1149002934 17:51775616-51775638 TGTATTTTAGTGGTGGAGAAAGG + Intronic
1149055780 17:52363453-52363475 GACATTATAGAGATGTAGAAAGG + Intergenic
1150460593 17:65347018-65347040 TGTTTTGTAGAGATGGAGAATGG + Intergenic
1150605570 17:66687769-66687791 AGGATTTCAGAGGTAGAGAAGGG + Intronic
1151647648 17:75444343-75444365 AGTATTTCTAAGATGGAGAAGGG + Intronic
1153174779 18:2358348-2358370 AGCATTTGATAAATGGTGAATGG + Intergenic
1153599049 18:6761143-6761165 AGCATCTTAGAGATGGGGGTGGG + Intronic
1156497640 18:37536606-37536628 TGCATTTTACAGATGCAGATAGG + Intronic
1156977776 18:43245624-43245646 AGTATTTAAGAGTTTGAGAAGGG - Intergenic
1156997022 18:43481124-43481146 AAAATTTTAAACATGGAGAAGGG + Intergenic
1158019236 18:52821748-52821770 TACGTTTTAGTGATGGAGAAGGG - Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158651144 18:59287129-59287151 CGCATTTTAGAGTTGGGTAAAGG + Intronic
1158875874 18:61734133-61734155 AGCATGTAAGAGATGTGGAAAGG - Intergenic
1159926474 18:74274004-74274026 AGCATTTGGGAACTGGAGAATGG - Intronic
1160493442 18:79356691-79356713 ACCAGATTAGAGATGGGGAACGG + Intronic
1161704766 19:5814452-5814474 AGCACCTGAGAGATGAAGAAAGG - Intergenic
1162283600 19:9720386-9720408 AGAACTTTGGAGAGGGAGAAGGG - Intergenic
1163350060 19:16770996-16771018 AGCCTTTAAGAGAGGGAGATGGG + Intronic
1164584189 19:29455777-29455799 TGCAATTGAGAGATGGAGAGTGG - Intergenic
1167087770 19:47321935-47321957 AACATTATAGAAATGGAGAGTGG - Exonic
1167651346 19:50731314-50731336 AGTATTATAGAGCTGGGGAATGG - Intergenic
1168508452 19:56955574-56955596 AGCTTTCTAGAGGTGCAGAATGG - Intergenic
927073547 2:19553989-19554011 AGCATTTGACAGATGGAGGCGGG - Intergenic
927271774 2:21218173-21218195 AGCATTTATAAGATGGAAAATGG - Intergenic
927577155 2:24209312-24209334 AGCCTTGTTGAGAAGGAGAAAGG + Intronic
928723406 2:34145745-34145767 GGCATTTTAAAGATGGAAAGAGG + Intergenic
929125262 2:38517839-38517861 CGTCTTTTAGAGATGAAGAAAGG + Intergenic
930419017 2:51126180-51126202 AGCATTTTCCAGTTGGAAAAGGG - Intergenic
931656662 2:64515440-64515462 AGGATTTTAAAGATGTAGAAAGG - Intergenic
932389942 2:71378859-71378881 AGCATCTTAGAGGAGTAGAAAGG + Intronic
932700735 2:73989584-73989606 AGCATTTTAGGGCTAGAGACAGG + Intronic
933159129 2:79005207-79005229 AGAATTTTACAGGTGGAAAAGGG + Intergenic
933679206 2:85084258-85084280 AGAATTATAGAAATGGAGAATGG + Intergenic
935049928 2:99516673-99516695 GCAATTTTAGAAATGGAGAATGG - Intergenic
935215182 2:100970280-100970302 AGGATTTGAGAGGTGGAGGATGG - Intronic
935286943 2:101573308-101573330 AGCATTGTCATGATGGAGAAGGG - Intergenic
935323291 2:101909377-101909399 AGAATTTGAGAGGTGGAAAAGGG - Intergenic
935402731 2:102677428-102677450 ACCAATTTAGAGACAGAGAAGGG - Intronic
935450965 2:103208842-103208864 TCCATTTTAGAGATAGGGAAAGG - Intergenic
935628890 2:105195660-105195682 AGGATTTTAGAGAAGGAGGCTGG + Intergenic
936385603 2:112025555-112025577 AGCATCTGAGATCTGGAGAAGGG + Intronic
936451094 2:112634606-112634628 AGCATTTGGGAGATGGGGATAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936889884 2:117356887-117356909 AGCATTATAGAGATGGATGGTGG - Intergenic
936892766 2:117391851-117391873 AGCGTTCTAGAGATGGAGAGAGG - Intergenic
937103162 2:119287085-119287107 TGCATCTTACAGATGGGGAAGGG - Intergenic
937611236 2:123864028-123864050 ATGATATTAGAAATGGAGAATGG + Intergenic
937892534 2:126949645-126949667 AACATTATTGAGATGGAGCAAGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
939087686 2:137741263-137741285 ATCATTGTAAAGATGGTGAATGG - Intergenic
939202191 2:139051348-139051370 TGTAGTTTAGAGTTGGAGAAAGG + Intergenic
939621507 2:144424889-144424911 AGCATTTGAGAATTGTAGAAAGG + Intronic
940078600 2:149773022-149773044 AGCATTTTATATGTGGAAAAAGG - Intergenic
940287467 2:152046954-152046976 AACATTATTGAGATGGAGTAGGG + Intronic
940861469 2:158774388-158774410 AGCCATTAGGAGATGGAGAAAGG + Intergenic
940909530 2:159198063-159198085 GGCACTTTGGAGATGGAGGAAGG - Intronic
941974636 2:171389584-171389606 AGCATTACTGATATGGAGAAAGG + Intronic
942041785 2:172072832-172072854 ACCATTTTCATGATGGAGAAAGG - Intronic
942180027 2:173371300-173371322 AGCATTTGAGGGAAGGAGCAAGG + Intergenic
942250991 2:174047755-174047777 GGCAATCTAGAAATGGAGAAAGG - Intergenic
942279942 2:174351032-174351054 AACATTCAAGAGATAGAGAATGG - Intronic
942525083 2:176844368-176844390 AGCATTTCAGGCATAGAGAATGG - Intergenic
943037050 2:182760166-182760188 AGCATTTTAGAGAGAGGGAGCGG - Intronic
943805370 2:192118480-192118502 GGCACTTCAGAGCTGGAGAAAGG - Intronic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946672646 2:222122656-222122678 AGCATTTAAGAGCTGAAGATGGG - Intergenic
947512573 2:230770929-230770951 AGCATTATACATATGGTGAAAGG + Intronic
947567733 2:231205402-231205424 TGAATTTTATAGATGAAGAAAGG + Intronic
948014460 2:234676712-234676734 AGCATTTTAGAGCGGAAAAAAGG + Intergenic
1168840321 20:905901-905923 ACCATTTTACAGATGAGGAAAGG + Intronic
1168920296 20:1529012-1529034 AGCATTCTAGAGATGTATAGTGG - Intergenic
1168971279 20:1932633-1932655 TGCATTTCAGATAGGGAGAATGG + Intronic
1169248658 20:4044007-4044029 CGCATTTTAGAGATGAGGAAGGG - Intergenic
1169523786 20:6401159-6401181 AACATTTTAGAGGTGGGCAAAGG + Intergenic
1169819744 20:9696985-9697007 AGAATCTAAGACATGGAGAAAGG - Intronic
1169922444 20:10749708-10749730 AGCATTTTATAAATTGAAAAAGG + Intergenic
1171332374 20:24351802-24351824 AACATTGAATAGATGGAGAATGG - Intergenic
1172453264 20:35044594-35044616 ACCATTTCAGAGATGGATACAGG - Exonic
1172583928 20:36069246-36069268 TGCATTTTAGAGATGTAAAGGGG + Intergenic
1172593308 20:36132455-36132477 AAGAGTTTTGAGATGGAGAATGG - Intronic
1173467175 20:43292498-43292520 ACCATTTTCCAGATGGAGAGAGG + Intergenic
1173652212 20:44673594-44673616 AGCATTTTAAAGATCAAGAATGG - Intergenic
1173896649 20:46556079-46556101 AGCATGTTAGAGATGGAGCCAGG + Intergenic
1174300711 20:49580211-49580233 CGCATTTTACAGATGAGGAATGG + Intergenic
1174598867 20:51707875-51707897 TGTATTTTAGAGATGGAGTCTGG + Intronic
1174669019 20:52288608-52288630 AGAATCTTGGGGATGGAGAAAGG + Intergenic
1174895587 20:54446236-54446258 AGAATTTCAGAGAAGGAAAATGG + Intergenic
1175068880 20:56315294-56315316 TACATTTTAGTGATGGAGAGAGG - Intergenic
1177051117 21:16235245-16235267 AGGATGATGGAGATGGAGAAAGG - Intergenic
1177627288 21:23679147-23679169 AGCATCTTAGTGTTTGAGAAAGG - Intergenic
1177785485 21:25666775-25666797 AGCATTTGAGAGATGGAGGTGGG - Intronic
1177905982 21:26971778-26971800 AATATTTTAGAGCTTGAGAAAGG - Intergenic
1178183025 21:30186320-30186342 TGCAATTTGAAGATGGAGAAAGG + Intergenic
1180916267 22:19490232-19490254 ATCAATTAAGAGATAGAGAATGG - Intronic
1180974767 22:19842345-19842367 TGCATTTCAGAGATGGGGAAGGG - Intronic
1182209025 22:28658588-28658610 AGAGTTATAGAGATGGATAATGG + Intronic
1182380814 22:29885336-29885358 AGAATTTAAGAGGTGGAGAAGGG + Intronic
1183772256 22:39937092-39937114 TGCATTTTAGAGGTGGGAAATGG - Intronic
949636915 3:5992729-5992751 AGTATTTTACATATGTAGAAAGG - Intergenic
950342892 3:12263249-12263271 AGAATATTAGAAATGAAGAAAGG + Intergenic
951422531 3:22504288-22504310 AGCATTTAAGAACTGGAGCAAGG + Intergenic
951698511 3:25470495-25470517 AGCATTTTCCAGATGAGGAAGGG + Intronic
951856437 3:27202444-27202466 AGCATGTTAGTGCTGTAGAAGGG + Intronic
952431667 3:33229707-33229729 TACATTTTGGAGATGGTGAAGGG - Intergenic
953011628 3:39031029-39031051 AGCATTTTTGAAATGGAAAATGG + Intergenic
953177371 3:40564212-40564234 AGCATCTTTAAGATCGAGAACGG - Intronic
953207942 3:40848490-40848512 AGCATTTATGAGATGGGGAGAGG - Intergenic
953444408 3:42950470-42950492 AGCATTTTACAGATGCATACTGG + Intronic
953899692 3:46833053-46833075 AGGATGTTGGAGCTGGAGAAGGG + Exonic
954576226 3:51677864-51677886 AGGGTTTCAGGGATGGAGAATGG - Intronic
955093718 3:55776427-55776449 ACCATTTCAGGGATGGAGCAGGG + Intronic
955910827 3:63858533-63858555 AACAGATGAGAGATGGAGAAAGG - Intronic
955991808 3:64635779-64635801 TGCCATTTAGAGATGCAGAATGG + Intronic
956072152 3:65464718-65464740 AGCACTTTAACGATGGGGAATGG - Intronic
957295399 3:78327041-78327063 AGCATCTTTAAGATCGAGAACGG - Intergenic
957579253 3:82049713-82049735 TACATTTTAGAGATGCAGGACGG - Intergenic
957928361 3:86844230-86844252 AGCATTTAAGAGCTGGGGTACGG - Intergenic
958692744 3:97488932-97488954 ATCATAATATAGATGGAGAATGG - Intronic
958696565 3:97535461-97535483 TGGGTTGTAGAGATGGAGAAGGG + Intronic
958825425 3:99024307-99024329 AGCATTTGAGAGAGAAAGAAAGG - Intergenic
959219165 3:103493846-103493868 ACCCTTTTACAGATGGAGAGTGG - Intergenic
960257467 3:115526299-115526321 AGCATTTTAAAAAGGGGGAAGGG - Intergenic
961185911 3:124914949-124914971 AACACTTAAGAGATGAAGAAAGG + Intronic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
961754348 3:129119181-129119203 GGCACTTTACAGATGGAGGAGGG + Intronic
962014655 3:131427547-131427569 AGCATGCTAGAGATGGGGGAGGG + Intergenic
962966624 3:140360444-140360466 AGCATTTGAGTGATCAAGAAAGG + Intronic
963331427 3:143920246-143920268 CGCATTGTGGAGATGGGGAAAGG - Intergenic
964885695 3:161479737-161479759 TGTCTTTTAGAGATGGGGAAAGG - Intergenic
965286567 3:166826569-166826591 AGCATCTTTAAGATCGAGAACGG + Intergenic
966438318 3:179914910-179914932 AGCAGTTTAGACAGGGAGAAAGG + Intronic
966762643 3:183430892-183430914 AGGATTTCAGAGCTGGAAAAGGG - Intergenic
966994902 3:185269887-185269909 AGCAGTTTGGAGATAGAGGAAGG - Intronic
967106251 3:186257072-186257094 AGCATTTTTGGGATGAAGAATGG + Intronic
967174111 3:186847059-186847081 TGCATTTTAGAGATGAGGAAAGG - Intronic
967373221 3:188772281-188772303 AGCATTTTAAGGCTGGAGATCGG - Intronic
967427845 3:189348028-189348050 AGCATTTTGCTGATGGAGAGTGG + Intergenic
967496388 3:190147737-190147759 AGCATCTTTAAGATGGAGAACGG - Intergenic
967616029 3:191567756-191567778 TTCATTTTAAAGATGAAGAAAGG - Intergenic
969212906 4:5701434-5701456 AGCATTTCAGGAAGGGAGAAAGG - Intronic
970042245 4:11809514-11809536 AGCATGTTTGAGATCTAGAATGG - Intergenic
970387825 4:15573692-15573714 GGCATTCTAGAAATGGGGAATGG + Intronic
970981570 4:22105000-22105022 AGAACTTTAGACATGGGGAAGGG - Intergenic
971584728 4:28390922-28390944 AGGATTTTAGAAATGGTAAAAGG + Intronic
971656206 4:29348511-29348533 AGCATTTAAAAGATGAAGCAAGG - Intergenic
971739165 4:30498774-30498796 AGCAGTTTAGAAATGGGAAAAGG + Intergenic
973021744 4:45211324-45211346 AGCATTTTGTTGCTGGAGAAAGG + Intergenic
973201931 4:47513576-47513598 AGCATATTTCAGATGGAGGAAGG + Intronic
973223554 4:47756236-47756258 GGCATTTTTGAGAGGTAGAAAGG + Intronic
973785277 4:54326821-54326843 AGGATTGTAGGGAAGGAGAAGGG - Intergenic
974424541 4:61723857-61723879 ATTATTTTAGGTATGGAGAAAGG - Intronic
975108288 4:70594559-70594581 AGTGTTTTAGAGAAAGAGAATGG + Intronic
975206776 4:71652866-71652888 AGCATTTTAAAAATGTAGATGGG + Intergenic
976084018 4:81388812-81388834 AGTATTCTAGAGATGGAGGTGGG + Intergenic
976495189 4:85721089-85721111 AGAAATTTAAAGATAGAGAAAGG + Intronic
976784107 4:88798292-88798314 AGCATTTGAGAAAGGGATAAAGG - Intronic
976901557 4:90183394-90183416 TGCATTTTATAAAAGGAGAAGGG + Intronic
977732987 4:100377961-100377983 AGCATTGTTGTGGTGGAGAAGGG - Intergenic
978728714 4:111999650-111999672 AGTATTTGAGAGAGAGAGAAGGG + Intergenic
979234967 4:118389480-118389502 AGTATTTTAGAGAAGGAAAAGGG + Intergenic
979461589 4:120990402-120990424 AGCAATTTAGAGAGGAAGATTGG + Intergenic
979466312 4:121042388-121042410 ATGCTTTTGGAGATGGAGAATGG + Intronic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980117879 4:128697330-128697352 AGCATGTGAGAGAAGCAGAAAGG + Intergenic
980370253 4:131860574-131860596 CTCATTTTAGAAATGGAGGAAGG - Intergenic
980575462 4:134680387-134680409 AGCATCTTTAAGATCGAGAACGG + Intergenic
980726493 4:136768278-136768300 AGAATTTTAGAGATAGAAAAAGG + Intergenic
981579764 4:146239606-146239628 AGCATTTTTGAGGGGGATAATGG - Intergenic
981991429 4:150925573-150925595 AGAATTTTAAAGTTGGAAAATGG - Intronic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
982266924 4:153546233-153546255 ATTATCTTACAGATGGAGAAGGG + Intronic
983000170 4:162404508-162404530 AGCATTTTATAGATGTTGAAAGG - Intergenic
984020142 4:174475357-174475379 AGCGTCGTGGAGATGGAGAAGGG + Intergenic
985507706 5:293371-293393 ATAATGTCAGAGATGGAGAAAGG + Intronic
986717977 5:10537827-10537849 AGCATCATGGAGCTGGAGAAGGG - Intergenic
987022424 5:13888313-13888335 AGCATGTTGTAGCTGGAGAAAGG - Intronic
988202978 5:28093366-28093388 AGAATGTTAGAGAAGAAGAATGG - Intergenic
988635132 5:32975312-32975334 AGCATTTTGGGGATGGAGCAGGG + Intergenic
988737551 5:34037943-34037965 TGAATTTTAAGGATGGAGAAGGG + Intronic
989119615 5:37991287-37991309 AGCATATTAGAGAGAGAAAAAGG + Intergenic
989217922 5:38924191-38924213 TGCCTTTTACAGATGAAGAATGG - Intronic
989574274 5:42974884-42974906 AGAAAGTGAGAGATGGAGAAGGG + Intergenic
989608769 5:43271864-43271886 AAAATTATAGAAATGGAGAACGG - Intronic
990278321 5:54223479-54223501 GTCATTTTAGAGATAGAAAAGGG + Intronic
990768450 5:59214720-59214742 AGTTGTTTAGAGATGAAGAAGGG + Intronic
991392735 5:66165786-66165808 GGGATTTTAAAGAAGGAGAAAGG + Intronic
992450368 5:76870792-76870814 AACATTTAAGAGCTGGAGAGGGG + Intronic
992462207 5:76971799-76971821 AAGATTACAGAGATGGAGAATGG - Intronic
992579645 5:78158577-78158599 ATTATTTTAAAGATGAAGAAAGG + Intronic
992938841 5:81741388-81741410 AAAGTTCTAGAGATGGAGAACGG + Intronic
993504093 5:88690792-88690814 AGCCTTGAAGAGCTGGAGAACGG + Intergenic
993790651 5:92206524-92206546 AGTATTTTTGAGAGGGAAAAAGG - Intergenic
994218937 5:97172289-97172311 AGCATTTTGGAGTTGGAGGGTGG - Intronic
994664463 5:102691053-102691075 AGCATTTCAGTGATGGAAAATGG - Intergenic
994710113 5:103256243-103256265 AGCAATCTAGGGAGGGAGAAGGG - Intergenic
994725590 5:103431644-103431666 ATCATTTGGGGGATGGAGAAAGG - Intergenic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995237695 5:109849038-109849060 AGTATTTTAGAGAGTGACAATGG - Intronic
995553927 5:113308475-113308497 AGGTTTTTAGAGATGGGGATGGG - Intronic
995891988 5:116964692-116964714 AGCATCTTAGAGATGGAAGGAGG - Intergenic
995899205 5:117048849-117048871 AGCATCTTTAAGATGGAGAATGG + Intergenic
996612381 5:125397828-125397850 ATCATTTTATAGTTGTAGAAGGG - Intergenic
998099275 5:139418466-139418488 AGAATTTTAGAGCAGGATAAAGG - Intronic
998186776 5:139986122-139986144 AGCATTTTGGAGATGCAAGAAGG - Intronic
998536574 5:142937830-142937852 ACAGTTTTAGAAATGGAGAATGG + Intronic
998940315 5:147274765-147274787 CTCATTTTATAGATGCAGAAAGG + Intronic
999926606 5:156385584-156385606 AGGATATTAGAGTTAGAGAAGGG + Intronic
1000565725 5:162845124-162845146 GCCATTTTATAGATGGAAAATGG + Intergenic
1000956358 5:167548221-167548243 AGAATTTCAGAGAGTGAGAAAGG + Intronic
1001683604 5:173576526-173576548 TGCATTTTGAAGAAGGAGAAGGG - Intergenic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1003302034 6:4892689-4892711 AGCACTTCAGAGGTGAAGAAAGG - Intronic
1003542880 6:7033492-7033514 AGAAATTTAGAGATGGAGAGAGG - Intergenic
1003628575 6:7765989-7766011 AAGATTTTTGAGATGGAGAAAGG - Intronic
1003795992 6:9604609-9604631 AACATTGTAGAAATGAAGAATGG - Intronic
1004082405 6:12407623-12407645 TGCCTCTTAGGGATGGAGAAAGG + Intergenic
1004210448 6:13636284-13636306 ACCATTTTACAGATGTAGAGCGG - Intronic
1004238997 6:13901843-13901865 AGCACTTAAGAGAAGGAGAAAGG - Intergenic
1004583466 6:16977094-16977116 AGCATTATAGAGATGGATATTGG - Intergenic
1004737275 6:18420108-18420130 AGCATTTCAGATAAGGAGATAGG - Intronic
1005149695 6:22734596-22734618 AGTTTTTAAGTGATGGAGAATGG + Intergenic
1006447849 6:34090008-34090030 AGCAAGTAAGAGGTGGAGAAGGG - Intronic
1006741144 6:36309828-36309850 AAAATGTTAGGGATGGAGAAGGG + Intergenic
1007269295 6:40624034-40624056 AGCAGCTCAGAGATGGATAATGG - Intergenic
1007306273 6:40907840-40907862 AGCAGCTGTGAGATGGAGAAGGG + Intergenic
1007868682 6:45006737-45006759 AAAAGTTTAGAGATGGAGAAGGG - Intronic
1008332952 6:50264241-50264263 AGCATTTTAGAGATGGTAGGTGG - Intergenic
1008880344 6:56375142-56375164 AGAATGTTAGAGACCGAGAAAGG + Intronic
1008893412 6:56522925-56522947 AGCTTTGTGGAAATGGAGAAAGG - Intronic
1008950131 6:57148639-57148661 AAAAGTTTAGACATGGAGAAAGG + Exonic
1009625443 6:66134880-66134902 GGAATTTTAGAGAGGGAGAAAGG - Intergenic
1010052572 6:71524956-71524978 CTCATGTTAGAGATGGCGAAAGG + Intergenic
1010132828 6:72515003-72515025 AGCAATTAAAAGATGGAGATTGG - Intergenic
1011022398 6:82829042-82829064 AGCTTATGAGAGAAGGAGAAGGG - Intergenic
1011372555 6:86652687-86652709 AAAATTTTAGAGATGGAAAACGG - Intergenic
1012319268 6:97822796-97822818 AGCATCCAGGAGATGGAGAAAGG + Intergenic
1012420771 6:99062598-99062620 AGCATTTAAAAGTTTGAGAATGG - Intergenic
1012458311 6:99431099-99431121 GGCAATATAGAGACGGAGAAGGG - Intergenic
1012532045 6:100249940-100249962 AGTATTTTCCAGTTGGAGAAAGG - Intergenic
1012704250 6:102500689-102500711 AGCATATTAGTCAGGGAGAATGG - Intergenic
1013158885 6:107522328-107522350 AGAATTTTCTAGATGCAGAATGG + Intronic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1014986359 6:128015717-128015739 AGTATTTGAGAAATGGTGAAAGG - Intronic
1015001458 6:128221591-128221613 ATGATTTAAGATATGGAGAAAGG - Intronic
1015323997 6:131904919-131904941 AGCATGTTTGAGATCTAGAACGG - Intergenic
1016113982 6:140259923-140259945 AGCATCTTTAAGATCGAGAATGG + Intergenic
1016145774 6:140671191-140671213 AGAAATTGAGACATGGAGAATGG - Intergenic
1016787692 6:148030753-148030775 AGCATTGTTGTGGTGGAGAAGGG - Intergenic
1018896369 6:168020803-168020825 AGGATTTAAAAGATGGAAAAAGG + Intronic
1019567016 7:1688886-1688908 AAAATTATAGAAATGGAGAATGG - Intronic
1020145684 7:5640550-5640572 AGTATTTTAGAGGAGGAGCAAGG - Intronic
1020529201 7:9308674-9308696 ATTATTTTACACATGGAGAAAGG - Intergenic
1020741435 7:12024092-12024114 ATCATTTTATAGATGGTGAAAGG - Intergenic
1021456388 7:20833551-20833573 AAAATTATAGAGATGGAGAACGG + Intergenic
1021564476 7:22003512-22003534 CCCATTTTAGAGATGGCAAATGG + Intergenic
1021637483 7:22706475-22706497 AGCATTTTTAAGATCAAGAATGG - Intergenic
1021695740 7:23274366-23274388 GTCATTTTAGAGATGGGGAGAGG + Exonic
1022325235 7:29324967-29324989 AGCATTTTAGACACAGAGACAGG - Intronic
1022373039 7:29788074-29788096 AGCATCTTTAAGATCGAGAACGG - Intergenic
1024012478 7:45281253-45281275 AACATTTTAGAAATGGAGAGTGG + Intergenic
1027276202 7:76559495-76559517 AGAATTATAGACATAGAGAATGG - Intergenic
1028332819 7:89617344-89617366 AGCATTTAAAATTTGGAGAAAGG - Intergenic
1031226014 7:119038842-119038864 ATCATTTTACAGATGAAGAGAGG - Intergenic
1031686007 7:124732266-124732288 AGCATCTTTAAGATGGAGAACGG - Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032610147 7:133403910-133403932 AGGATTTTAGAGACAGAGAGAGG - Intronic
1032807401 7:135370391-135370413 AGCATTCTAGACAAGGAGAATGG - Intronic
1034250240 7:149684519-149684541 ATACTTTTAGAGATGGATAATGG - Intergenic
1034535087 7:151721260-151721282 GGCATTTTCGAGATGCAGAGAGG - Intronic
1034880218 7:154757253-154757275 AGGATGTGAGGGATGGAGAAGGG - Intronic
1035032917 7:155873965-155873987 ATCATGTTGGAGATGGTGAAAGG + Intergenic
1035689833 8:1552970-1552992 AGCATTGTAGGAATGCAGAACGG + Intronic
1036438909 8:8762503-8762525 AGCATTTTAGAGGTGCCCAAAGG + Intergenic
1037017887 8:13931187-13931209 AGCATTTTAGAAATGAAGTTTGG - Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037302445 8:17466858-17466880 AGCATGTTAGAAATAGATAAAGG + Intergenic
1038377232 8:27053589-27053611 GACATTTTAGAAATGGAGAATGG + Intergenic
1040379665 8:46860258-46860280 AGCATTTTTGAGAGTGTGAATGG + Intergenic
1041311695 8:56523975-56523997 AGCATTTTGGAGACTGGGAATGG + Intergenic
1041767504 8:61434310-61434332 AGCATTTAAGAGATAGTAAAGGG + Intronic
1041942023 8:63399284-63399306 AACATTTCAGAAAAGGAGAAAGG + Intergenic
1042668059 8:71229263-71229285 AGTATGTCAGGGATGGAGAAGGG - Intronic
1042693050 8:71525088-71525110 CTCATTTTAGAGATGAAGATGGG + Intronic
1042925695 8:73966315-73966337 AGCTTTTTATGGAGGGAGAATGG + Intronic
1044153951 8:88819254-88819276 AGCTTTTTAAAGATGTAGAATGG - Intergenic
1044815947 8:96113005-96113027 ACCATTTTATAGTTGAAGAAGGG - Intergenic
1044844605 8:96367678-96367700 AAAATTATAGACATGGAGAATGG - Intergenic
1044865423 8:96566029-96566051 AACATTTTACAGATGGGAAAAGG - Intronic
1044897891 8:96911978-96912000 ATCACTTTACAGATGGGGAAAGG - Intronic
1045239147 8:100383545-100383567 AGCATTTTAGAATTGGAGGTAGG + Intronic
1045665877 8:104483772-104483794 CCCATTTTACAGATGAAGAATGG + Intergenic
1046610930 8:116424820-116424842 TGCATTTTGAAGACGGAGAAAGG - Intergenic
1047473791 8:125205449-125205471 AACATTTTACTGATGGATAAGGG - Intronic
1047769964 8:128022732-128022754 ATCATTTTATAGATGAAGAAGGG - Intergenic
1048179382 8:132181138-132181160 GACATTTCAGAGATGGAAAAAGG + Intronic
1048812041 8:138297394-138297416 ACCATTTTAGAGGTGGAGCCAGG + Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1051506885 9:17837434-17837456 AACCTTTTAGAGATGGATCAGGG + Intergenic
1052736529 9:32348023-32348045 AGCATTTTAGAGAGTGAGATGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1054746528 9:68859370-68859392 AGCATTTGATACTTGGAGAAAGG - Intronic
1054840441 9:69732483-69732505 AGTATTTTGGAGATGGGGAGGGG + Intronic
1055761542 9:79614153-79614175 TGCTTTATGGAGATGGAGAATGG + Intronic
1056409231 9:86309388-86309410 AGAATTTTAGAGGAGGAGAAAGG + Intronic
1056614444 9:88151650-88151672 GACATTATAGAGATGGAGAGTGG - Intergenic
1057867935 9:98696192-98696214 AGGATTTAAAAGATGAAGAAAGG + Intronic
1058044757 9:100345262-100345284 AGCATTATAGAGTTGTAGTAAGG - Intronic
1058763608 9:108160476-108160498 GGTATCTCAGAGATGGAGAAGGG - Intergenic
1058854936 9:109052221-109052243 AGCATTTTAGAAATGGTAATGGG - Intronic
1059454967 9:114394676-114394698 GGCATTTAACAGATGAAGAAAGG + Intergenic
1059756158 9:117295564-117295586 AGCATTTTAAAGATGAAAAAGGG - Intronic
1059756369 9:117297422-117297444 AGCATTTTAGAGATGAAAAAGGG - Intronic
1060471702 9:123953169-123953191 AGCAGGTTAGAGATGAAGAAAGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060854704 9:126906059-126906081 AGCACTAAATAGATGGAGAAAGG + Intergenic
1061077203 9:128348828-128348850 ACCATTTTCCAGATGGAAAAAGG - Intronic
1061414134 9:130436900-130436922 TCCATTTTACAGATGCAGAAAGG + Intergenic
1061506333 9:131033868-131033890 GGCATTAGAGAGATGGAGAAGGG + Intronic
1062692114 9:137847350-137847372 AGCATCTTTAAGATCGAGAACGG - Intronic
1186044388 X:5519308-5519330 ATCGCTTTGGAGATGGAGAAAGG - Intergenic
1186112686 X:6274660-6274682 AGCATCTTTAAGATCGAGAACGG + Intergenic
1186134054 X:6500235-6500257 ATCATTTTACAGAAGGTGAAAGG + Intergenic
1186210801 X:7248793-7248815 AGAATTCTAGAGATGGATAGTGG - Intronic
1186960079 X:14727087-14727109 TACATTTTAGAGATGGACATCGG + Intronic
1187283812 X:17883562-17883584 AGGATTTTAGATATGTAGAAGGG + Intergenic
1187647679 X:21366792-21366814 AGTGTATGAGAGATGGAGAATGG - Intergenic
1187654861 X:21460293-21460315 GGTATAGTAGAGATGGAGAAAGG - Intronic
1187681939 X:21776711-21776733 TGAAATTTAGAGATGGAAAATGG - Intergenic
1187897480 X:23996219-23996241 AGCATTTTTTGGATGTAGAAAGG - Intronic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188573015 X:31612060-31612082 AACATTCTAGAGATGGATAGTGG - Intronic
1188666340 X:32825916-32825938 ATCATTCTAGAGATGGATAGCGG + Intronic
1188920824 X:35974491-35974513 AGCATATAAAACATGGAGAATGG + Intronic
1189324261 X:40103462-40103484 AGCTTTTGAGAGATGAAGGAGGG + Intronic
1189486827 X:41440234-41440256 AGCATTCTAGAGAAGGATAGTGG - Intergenic
1189550366 X:42086426-42086448 AGCATTCTAAAGAGGGGGAATGG - Intergenic
1189897388 X:45669624-45669646 AGGATTGTAGAGTTGGGGAAGGG + Intergenic
1190301871 X:49061801-49061823 CCCATTTTAGAGATGAGGAAAGG - Intronic
1190967676 X:55316919-55316941 AAAATTGTAGAAATGGAGAACGG - Intergenic
1191825720 X:65362951-65362973 AGCATGTTTGAGATCAAGAATGG - Intergenic
1191861635 X:65670292-65670314 AGCGTGTGACAGATGGAGAAAGG + Intronic
1191870974 X:65744715-65744737 AATATTATAGAAATGGAGAAGGG + Intergenic
1192259980 X:69500074-69500096 TGCATTCTAGAGAAGAAGAAGGG - Intergenic
1192276249 X:69634176-69634198 TGCAATTTAGAAATGGACAAAGG - Intronic
1192475688 X:71440138-71440160 AAAACTATAGAGATGGAGAACGG - Intronic
1192722947 X:73719416-73719438 GGCATTTTGGAGATGGGGGATGG - Intergenic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1193684630 X:84562076-84562098 AGCATTTTAGCTATGCAAAATGG + Intergenic
1193886088 X:86985033-86985055 AGCATCTTTAAGATCGAGAATGG - Intergenic
1195000691 X:100640595-100640617 AGAATTTCAGAGAAGGAGAATGG - Intergenic
1195144668 X:102001151-102001173 AGCATCTCAGAGATGGAAGATGG + Intergenic
1195272131 X:103242457-103242479 GGCATTTTAGAGCAGGAGATGGG - Intergenic
1195283839 X:103363235-103363257 CACATTTTAGAGATGGATACTGG + Intergenic
1195738255 X:108035464-108035486 AGCATTTCAGAGACCAAGAATGG - Intergenic
1195842237 X:109186818-109186840 AGAAGTTTATAGATGGAGAAGGG + Intergenic
1196123875 X:112079619-112079641 AGGAAATTAGAGATGCAGAAGGG - Intronic
1196192874 X:112812825-112812847 AGAATTTTGGAGATGGAGGCGGG - Intronic
1196679019 X:118451729-118451751 AGCATTTTAGGGATTGACATAGG + Intergenic
1196731448 X:118944892-118944914 AGAATTCTAGAGATGGAGGGTGG + Intergenic
1197306853 X:124853159-124853181 AGCATGTTAGATATTGACAAGGG + Intronic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1199870644 X:151895407-151895429 ATTCTTTTTGAGATGGAGAAGGG - Intergenic
1200024540 X:153245790-153245812 AGAGTTTTAGAAATGGTGAAGGG + Intergenic
1200375800 X:155778754-155778776 AACATTTTATAGCTGGAGAAAGG + Exonic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201311999 Y:12605639-12605661 AGCATTGTGGACATGGACAAGGG + Intergenic