ID: 1032357883

View in Genome Browser
Species Human (GRCh38)
Location 7:131227132-131227154
Sequence CAGGGAAAGAAACGGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032357883_1032357889 -4 Left 1032357883 7:131227132-131227154 CCTGTAACCCGTTTCTTTCCCTG 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1032357889 7:131227151-131227173 CCTGCAGTGTCCTGACACCTGGG 0: 1
1: 0
2: 0
3: 24
4: 224
1032357883_1032357887 -5 Left 1032357883 7:131227132-131227154 CCTGTAACCCGTTTCTTTCCCTG 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1032357887 7:131227150-131227172 CCCTGCAGTGTCCTGACACCTGG 0: 1
1: 0
2: 2
3: 27
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032357883 Original CRISPR CAGGGAAAGAAACGGGTTAC AGG (reversed) Intronic
901023685 1:6267979-6268001 CAGTGAAAGAAGCCGGTCACAGG + Intronic
902254567 1:15179407-15179429 AAGGAAAGGAAACGGGATACAGG + Intronic
904939236 1:34153315-34153337 AAGTGAAAGAAACCAGTTACAGG - Intronic
905191624 1:36239592-36239614 CAGGGAAACAAAGGCCTTACAGG - Intronic
905984401 1:42265800-42265822 CATGGAAAGATACTGGCTACAGG + Intronic
907885641 1:58590290-58590312 AAGGAAAAGAAGCAGGTTACAGG + Intergenic
914804585 1:150982978-150983000 CAAGGAAAGGAACAGGTGACTGG + Intronic
916448174 1:164893217-164893239 CAGGGAAAGAAAGTGGGCACAGG - Intronic
917708639 1:177660527-177660549 GAGTGAGAGGAACGGGTTACAGG - Intergenic
918516791 1:185371971-185371993 CATGGAAAGAAACATGTGACAGG + Intergenic
918691666 1:187488171-187488193 CTGGGAGAGAAAGGGGTTAATGG - Intergenic
919186815 1:194161645-194161667 CAGGAAAAGAAACAGGTTGGAGG + Intergenic
919878308 1:201886535-201886557 AAGGGAAAGAAACGCTTTCCTGG - Intergenic
924627954 1:245711402-245711424 CAGTGAATGAAACAGGTTCCAGG + Intergenic
1063346782 10:5319064-5319086 CAGGGAAACAAAAGGGTAAGGGG + Intergenic
1063469103 10:6270249-6270271 GAGGGAAAGCAACTGGTTCCGGG - Intergenic
1064022477 10:11820983-11821005 GAGGAAAAGAAATGGTTTACAGG - Intergenic
1064191888 10:13213668-13213690 CAGGGAAAGAAACAGGCTTTCGG - Intergenic
1067031364 10:42880289-42880311 CAGGGAAGGAAATGGATTAAAGG + Intergenic
1068399845 10:56513978-56514000 CAGGAAAAGAAACTGGTCTCTGG + Intergenic
1069143221 10:64854946-64854968 CAGGAAAAGAAACCGTTTTCGGG - Intergenic
1069949480 10:72009268-72009290 AGGGGAAAGAAACGCGTTAAAGG + Exonic
1071472408 10:85993013-85993035 AAGGGAAAGAAATGGTTTGCAGG + Intronic
1071995406 10:91143377-91143399 CAGGGAAAGACAGTGGTGACTGG + Intergenic
1072000916 10:91194881-91194903 AAGGGAAAGAAAAGAGTTTCTGG + Intronic
1072892333 10:99335003-99335025 CAGGGAAAGAACAGGCTTTCGGG - Intronic
1076356655 10:129858223-129858245 AAGGGAGAGAAACGTGTCACCGG - Intronic
1076432925 10:130419711-130419733 CAGGGACAGAATCTGGTTACTGG - Intergenic
1080214256 11:29823239-29823261 CAGGCAAAGAATGGGGTTATGGG - Intergenic
1081540877 11:44033698-44033720 CAGGGGGAGAAATGGGTCACTGG + Intergenic
1082139788 11:48595565-48595587 CAGCCTAAGAAAGGGGTTACAGG + Intergenic
1082878124 11:58009173-58009195 AAGGGAAATAAATGGGATACAGG + Intergenic
1083103443 11:60334225-60334247 CAGGGGGAGAAAGAGGTTACAGG + Intergenic
1086620274 11:88879572-88879594 AAGGGAAGGAGACTGGTTACAGG - Intronic
1088800259 11:113299070-113299092 CAGGGAAAAAAACGGTATTCAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089634535 11:119803863-119803885 CAGGGAAGGAAAGGTGTTTCTGG - Intergenic
1092654815 12:10673604-10673626 AAGGGAAAGAATGAGGTTACAGG - Intronic
1093171656 12:15867897-15867919 CAGGGAAAAAAACATGATACAGG + Intronic
1093195568 12:16126254-16126276 CAGGGAAAGAACTGGTTTTCTGG - Intergenic
1098898145 12:76085165-76085187 CGGGGAAGGAAAACGGTTACCGG - Intergenic
1100160315 12:91852681-91852703 AAGTGAAAGAAACCGGTCACAGG + Intergenic
1100694955 12:97082586-97082608 CAGAGAAACAAATGGGTTAAGGG - Intergenic
1101903976 12:108811858-108811880 GAGGGAAAGAAAGGGCTTATCGG + Intronic
1103608481 12:122106231-122106253 AAGGGAGAGAAAAGGGTTTCAGG - Intronic
1105070732 12:133232949-133232971 CAGGGACAGAAAAGGGGTAACGG + Intronic
1107962141 13:45568002-45568024 CAGGGTAAGAAAAGGCTTGCAGG - Intronic
1112144192 13:96679706-96679728 CTGGGAAAGAAGGGGGCTACAGG - Intronic
1112209852 13:97365077-97365099 AAGGGAAAGAAACAGGTTAGCGG - Intronic
1113527505 13:110992199-110992221 CAGGAAAAGAGACGGGTTGGGGG - Intergenic
1115205110 14:30894694-30894716 GAAGGAAAGAAAGTGGTTACAGG + Intronic
1116117040 14:40667147-40667169 CAAGGAAAAAAAAGTGTTACAGG - Intergenic
1118065873 14:62189674-62189696 CAGAGGAAGAAAGGGGTGACAGG + Intergenic
1118675743 14:68182931-68182953 CAAGGAAAGAAAAGGAATACAGG - Intronic
1121707605 14:96010736-96010758 CAGCCAAAGAAAGGGGCTACAGG + Intergenic
1132667545 16:1089104-1089126 CAGGGAAAGGAACGGTTGTCTGG + Intergenic
1133294894 16:4746901-4746923 CAGGGAGAGAAATGGGTTTCTGG - Intronic
1134336105 16:13300972-13300994 CAAGGAAAGAAAAGAGTCACAGG - Intergenic
1135358841 16:21793733-21793755 TAGGGAAAGAAACTGGAAACTGG - Intergenic
1135457397 16:22610169-22610191 TAGGGAAAGAAACTGGAAACTGG - Intergenic
1137299092 16:47129579-47129601 CAGGGAAATAAAGGGCTTATAGG + Intronic
1139104715 16:63814535-63814557 CAGTGATAGAAATGGGTGACTGG + Intergenic
1140822847 16:78679210-78679232 CATGGTAAGAAACGGGTTCTAGG - Intronic
1141676843 16:85522235-85522257 CAGGGAAAGAGGTGGGATACTGG - Intergenic
1146614949 17:34348998-34349020 CAGTGAGAGAAATGGGTTCCAGG - Intergenic
1147897090 17:43758003-43758025 AAGGGGAAGAAACAGGTTCCAGG - Intronic
1148243607 17:46015916-46015938 CAGGGAGAACAACGGGTTAGGGG - Intronic
1149649423 17:58267703-58267725 CAGGGGAAGGAAAGGGTCACAGG - Intronic
1149794358 17:59505737-59505759 CAGGGAATCAAACCGGTTAGAGG + Intergenic
1151471690 17:74322332-74322354 GAGGGACAGAAACGGGTTCCAGG + Intergenic
1152041587 17:77907074-77907096 CAAGGGAAGAAACAGGTTTCTGG - Intergenic
1153312265 18:3688707-3688729 CAGGTAAAGGAATGGGTTAAAGG + Intronic
1156127798 18:33928200-33928222 CAGGGAAACATATGGTTTACTGG - Intronic
1157628488 18:49072618-49072640 CAGGAAATGAAATTGGTTACAGG - Intronic
1158220879 18:55149588-55149610 CAGAGAAAGAAACCGGATCCTGG - Intergenic
1159781820 18:72668462-72668484 AAAGGAAAGAAAGGAGTTACAGG - Intergenic
1159855755 18:73585867-73585889 CAAGGAAAGAATATGGTTACTGG - Intergenic
1159917427 18:74199407-74199429 CAAGGATAAAAACGAGTTACTGG + Intergenic
1160838449 19:1135739-1135761 CAGGGAGGGAAACAGGCTACGGG + Intronic
1162438762 19:10679954-10679976 CAGGGAAAGGACAGGGTTCCAGG + Intronic
1164405395 19:27940591-27940613 AGGGGAAAGAAATGGGTCACTGG - Intergenic
1165694137 19:37887699-37887721 CAAGGAAAGAAACGGCTCAGAGG - Exonic
1166986329 19:46661627-46661649 CAGGGGGAGAAAAGGGTTAGGGG + Intergenic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
929372357 2:41241593-41241615 CTGGGAAAGAACTGAGTTACAGG + Intergenic
936838105 2:116732557-116732579 CAGGGAAAGGACCTGGTTTCTGG - Intergenic
937194591 2:120141305-120141327 CTGGGAAAGAAAGTGGTCACTGG - Intronic
937872233 2:126794095-126794117 CAGGGAAAGAAGTGGGTCTCAGG - Intergenic
941219845 2:162763597-162763619 CAGGGAGAGAAATGGGGTATAGG + Intronic
947516735 2:230812203-230812225 CAAGGAGAGAAACCGGTTTCAGG - Intronic
1169009412 20:2237836-2237858 CATGGAAAGAACCTGGTTCCTGG - Intergenic
1174113759 20:48213485-48213507 CAGAGAAAGGAATGGATTACAGG - Intergenic
1182606794 22:31512040-31512062 CAGGTAAAGAAATAGGTTATTGG + Intronic
1184116944 22:42427716-42427738 CAGTGAAAGAAGCGGGTCACCGG + Intronic
1184423823 22:44397341-44397363 CAGTGAAAGAAACAGGTTCAGGG - Intergenic
1184942127 22:47776700-47776722 CAGGGAAAAAGACGGGTTGGAGG - Intergenic
949247461 3:1942215-1942237 CAGGGAAAGAAAAGGGAACCCGG - Intergenic
949940674 3:9151926-9151948 CAAGGATAGAACCGGGTTCCTGG + Intronic
949970530 3:9398988-9399010 CTGGGAAAGAAATGAGTTACCGG - Intronic
950538762 3:13597519-13597541 CAGGGAAAGAGGCAGGTCACAGG - Intronic
950790316 3:15466418-15466440 CAGGGACAGAAAGGGGATAGTGG - Exonic
951596351 3:24322533-24322555 CAGGCAAAGAAAGGAGTTTCAGG - Intronic
952808046 3:37375645-37375667 CAGAGAAAGAAAAAGGTTTCTGG - Intergenic
953056034 3:39387878-39387900 CAGGGACAGGAACGGGGTCCTGG + Intronic
955402464 3:58602684-58602706 AAGTGAAAAAAACAGGTTACAGG + Intronic
961885571 3:130094356-130094378 CAGGGACAGAGACGGGTTCATGG + Intronic
962955517 3:140262889-140262911 CAGAGAAAGAAAGGGATCACTGG + Intronic
966537467 3:181050844-181050866 CAGGCAAAGAACCGTTTTACAGG - Intergenic
966976379 3:185087106-185087128 CAAGGATTGAAACGGGTTTCTGG + Intronic
967778463 3:193409050-193409072 CAGGGAGAGGAACTGGTAACGGG + Intronic
968185070 3:196627369-196627391 CAGGGGAAGAAAAGAGGTACTGG - Intergenic
970226067 4:13858083-13858105 CTGGGAGAGAAATGGATTACTGG + Intergenic
972314592 4:37914329-37914351 CTGGGAAAGAAACAGATTGCAGG - Intronic
973279013 4:48340959-48340981 CAGGGGAAGAAACAGGACACAGG + Intergenic
973340773 4:49001591-49001613 AAGGGGAACAAATGGGTTACGGG + Intronic
973599893 4:52531779-52531801 CAGGAAATGAAATGGGTTAGAGG - Intergenic
973954721 4:56050755-56050777 CAGGGAAAAAATCATGTTACTGG + Intergenic
976218019 4:82732803-82732825 CAGGGAAAGAAACGGAATGTGGG + Intronic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
986277211 5:6287086-6287108 CAGGGAAAAACACGGGTTAAGGG + Intergenic
986828727 5:11551280-11551302 CAGGGAAAGAAATGGGGTAAAGG - Intronic
989782426 5:45284341-45284363 TTAGGAAAGAAAGGGGTTACAGG - Intronic
990238840 5:53796932-53796954 CAGGGAAAGAGACAGCTCACCGG + Intergenic
993700624 5:91114557-91114579 AAGGGAAGGAAATGGGTTTCAGG + Intronic
996164735 5:120210839-120210861 CAGGCGAAGAAAGGAGTTACAGG - Intergenic
996830345 5:127733692-127733714 CAGGGAAAGTGACAGGTTATAGG - Intergenic
998908547 5:146932978-146933000 CAGGTAAAGAAACAGTTTCCTGG - Intronic
999595272 5:153196612-153196634 CAGTGAAAGAGACTGGTTATGGG + Intergenic
1001422160 5:171596343-171596365 CAGGGAAGGCAAGGGGTTTCTGG + Intergenic
1003494677 6:6653764-6653786 GAGAGAAAGAAATGGGTTAAAGG - Intronic
1007343527 6:41209275-41209297 CAGGGAAGGAAGCAGGTGACAGG - Intergenic
1007346777 6:41236917-41236939 CAGGGAAGGAAGCAGGTGACAGG + Intronic
1007515942 6:42411507-42411529 CAGAGAAGGAAACGGGACACAGG + Intronic
1007588788 6:43008919-43008941 AAGGCAAAGAAACGGGTAGCTGG + Intronic
1008701724 6:54108628-54108650 AAGGGAAAGAAAATGGTTAGAGG + Intronic
1010585494 6:77653276-77653298 TAGGGAAAGAAAAGGGTTTTGGG + Intergenic
1011037442 6:82993097-82993119 CAGAGAAAGAAACGGGGTCGGGG + Intronic
1012529155 6:100213554-100213576 CAGAGAAAGAAAGGGATAACTGG + Intergenic
1012673429 6:102085855-102085877 CAGGGTAAGAAAGGGTTTAGAGG + Intergenic
1017027208 6:150191925-150191947 TAGGGAAAGAAGAGGGTTCCAGG + Intronic
1020199898 7:6071532-6071554 CAGGCAAAGAAAGACGTTACTGG - Intergenic
1020673402 7:11148546-11148568 CAGTGAAAGAAACAGGGTAAAGG - Intronic
1022192291 7:28027846-28027868 CAGGGAAAGAAACAGGCATCGGG - Intronic
1023587294 7:41743956-41743978 CAGGGAGAGAAAAGGGTGAAAGG - Intergenic
1024950900 7:54859465-54859487 CAGGGAAAGAAATTGGGGACGGG + Intergenic
1026132866 7:67634852-67634874 GGGGGAAAGAAAGGGGTGACCGG - Intergenic
1032152372 7:129440428-129440450 CAGGCAAAGATATGGGTGACAGG - Intronic
1032357883 7:131227132-131227154 CAGGGAAAGAAACGGGTTACAGG - Intronic
1035394911 7:158528374-158528396 CAGGGCAAGAGACGGCTGACCGG - Intronic
1037338786 8:17818688-17818710 CAGGGGAAGGAACGGGTAATAGG - Intergenic
1037599607 8:20382929-20382951 CAGGGAGAGAAACAGGAGACGGG - Intergenic
1037832064 8:22195606-22195628 CAGGGAAAGAACAGGGTCAGAGG - Intronic
1037855913 8:22370526-22370548 CAGTGAAAGAAACTGGATCCAGG + Intronic
1041931239 8:63289096-63289118 AAGGGAAAGAAACAGATCACAGG - Intergenic
1042454111 8:68979690-68979712 CAGAGAAAGAAAGAGGTTAAGGG + Intergenic
1043857982 8:85283664-85283686 CAGGGAAAGAACCTGTTTTCTGG + Exonic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1048008601 8:130438894-130438916 CTGGGAAAGAAGGGTGTTACGGG - Intronic
1048437607 8:134432624-134432646 AAGGGAAAGAAAAGGGGCACAGG + Intergenic
1048879822 8:138863158-138863180 CAAGGAAAGAAACGGGGAGCCGG - Intronic
1050243446 9:3661627-3661649 CAGAGAAAGAAATGGGCTAGAGG - Intergenic
1050335281 9:4584405-4584427 CAGGGAAGGTAACTGGTTCCAGG - Intronic
1054894341 9:70291231-70291253 CTGGGAAACATATGGGTTACAGG - Intronic
1055312560 9:74998160-74998182 CAGGGAAAGAAAAGATTTAATGG - Intronic
1057579621 9:96274804-96274826 CAGAGAAAGAAAAGGGCAACAGG + Intronic
1059145487 9:111896452-111896474 CAGAAAAAGACACGGGTTCCGGG - Intergenic
1060593326 9:124833010-124833032 CTGGGAAAGAAACTGGGTCCTGG + Intergenic
1061732577 9:132627707-132627729 CAGGGCAAGAGACAGGTTCCTGG - Intronic
1061835683 9:133328050-133328072 CAGGGAAAGGATCGGGGTGCAGG - Intergenic
1062635321 9:137487500-137487522 CAGGAAAAGAACCGGGGCACTGG + Intronic
1185699978 X:2223530-2223552 CAGGGCAAGACACGGGACACAGG - Intronic
1187041276 X:15598740-15598762 CAGGGGAAGAAATGGTTTAGAGG - Intronic
1189638422 X:43038890-43038912 GAGGGATAGAAACTGGTTACAGG - Intergenic
1190383501 X:49862346-49862368 CAGGCAGAGAAACAGGTTACAGG - Intergenic
1200212614 X:154353514-154353536 CAGTGACAGAAACGGGTGGCAGG - Intronic
1201748206 Y:17403556-17403578 CAAAGAAAGAAATGGTTTACTGG + Intergenic