ID: 1032359797

View in Genome Browser
Species Human (GRCh38)
Location 7:131244748-131244770
Sequence AGGACCCCTGTGCCAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032359797 Original CRISPR AGGACCCCTGTGCCAACACA GGG (reversed) Intronic
900073877 1:796064-796086 AGGACCCCTGAGACAACATTTGG + Intergenic
900473101 1:2864080-2864102 AGGTCCCCTGAGCCGGCACATGG - Intergenic
900478094 1:2885490-2885512 AGGTCCCCTGTGCAGCCACACGG - Intergenic
900515368 1:3079337-3079359 AGGAGCCCTGTGCACACACAGGG - Intronic
900515379 1:3079383-3079405 AGGATCCCTGTGCACACACAGGG - Intronic
901554371 1:10019843-10019865 AGGAGCCCTGTGCCAGAACCAGG + Intergenic
902247364 1:15129622-15129644 AGGATCCCTGTGGCTACATAGGG - Intergenic
902840805 1:19072633-19072655 AGCACCCCTGTGCAGACACTAGG + Intergenic
902998863 1:20249968-20249990 AGGACCCCTGTGGTTACATAAGG - Intergenic
903041746 1:20535914-20535936 AGGACCCCTGTGATGACACCAGG - Intergenic
903060237 1:20664110-20664132 GGGACCCCTGTGCCACCCCATGG + Exonic
903127798 1:21259562-21259584 AGGTCCCATGTGCCAAACCAGGG - Intronic
904289606 1:29475625-29475647 AGGCCGCCTCTCCCAACACAGGG - Intergenic
905277757 1:36829943-36829965 AGGACCCCTGTCCTAAGAGAAGG - Intronic
905657130 1:39692176-39692198 AGGACCCCTATGCCTAGCCATGG + Intronic
906691867 1:47798058-47798080 AGGCCCCCTAGCCCAACACAGGG - Intronic
909040825 1:70649326-70649348 GTGACCCCTGTGCCACCACGGGG + Intergenic
910202512 1:84714040-84714062 AAGACCCCTGTGGCTACACTGGG + Intergenic
910239144 1:85067677-85067699 AGGACCCTTGTGACTACACTGGG - Intronic
915647582 1:157284721-157284743 AGGAACACTGTGCCCTCACATGG + Intergenic
919549088 1:198962132-198962154 AGGACACCCTTTCCAACACATGG - Intergenic
920235126 1:204497767-204497789 AAGATCCCTCTGCCAACACCTGG - Intergenic
920337330 1:205253903-205253925 AGGGCCCTCGTGCAAACACATGG - Intronic
922269735 1:224020972-224020994 AGGACCCCTGAGACAACATTTGG + Intergenic
924208688 1:241742794-241742816 AGGACCCCTTTCCCATAACACGG + Intronic
1063041129 10:2338367-2338389 AGGAACCCTGTGTCCTCACATGG + Intergenic
1066249407 10:33618325-33618347 AGGGCCCCTGCGACCACACAGGG - Intergenic
1069548119 10:69343154-69343176 AGGACCCTTCTGAGAACACAGGG - Intronic
1072303230 10:94082472-94082494 AGGGGCCCTGTGCAATCACAGGG + Intronic
1073180407 10:101579811-101579833 AGGAACCCTGGCCCAACAGAGGG + Exonic
1073488068 10:103834230-103834252 AGGACCCCTCGGCCACCACATGG + Intronic
1074519202 10:114202041-114202063 AGCACACCTGTGCACACACAGGG + Intronic
1077239605 11:1503602-1503624 GGGACACCTGTGCCCACGCAGGG - Intergenic
1077721727 11:4637056-4637078 AGATCCCCTGTGCGACCACAAGG + Intergenic
1078100335 11:8326744-8326766 AGAAAGCCTGTGCCATCACAGGG - Intergenic
1078725187 11:13923818-13923840 AGGAGCCCTGTGCCAAGAACTGG + Intergenic
1080872356 11:36248021-36248043 AAGACCCATATGACAACACAGGG - Intergenic
1081188300 11:40072303-40072325 AGGACCCCTGTGGCTACATTAGG - Intergenic
1083626907 11:64076512-64076534 CAGACCCCAGTGCCAGCACAGGG - Intronic
1084212940 11:67632188-67632210 AGGGCCCCTGTGTGGACACACGG - Intronic
1084285898 11:68130221-68130243 AGGATCCCTGTGTTACCACAAGG + Intergenic
1089933652 11:122340755-122340777 TGTAGCCCAGTGCCAACACATGG + Intergenic
1090320714 11:125841040-125841062 AGGAGCTCTGTGCCAGGACATGG + Intergenic
1090646932 11:128773886-128773908 AGCAGCCCTGTGCAAAGACAGGG + Intronic
1092016721 12:5165507-5165529 AGGAGCCTAGTGCCAAAACATGG - Intergenic
1092920683 12:13229054-13229076 ACGACCCCTCTGCCAAAAAATGG + Intergenic
1098938642 12:76509069-76509091 AGGACCCCTTTCCAAAAACAAGG + Intronic
1099474937 12:83096693-83096715 AGGACCCCTCCCACAACACAAGG + Intronic
1101277428 12:103217844-103217866 AGGACCCCTGGGACCACACTAGG - Intergenic
1103605903 12:122085976-122085998 AGGACCCCTGTGATTACACCAGG - Intronic
1106724883 13:32473812-32473834 AGGACCCTTGTGATAACACTGGG + Intronic
1107744552 13:43490660-43490682 AGGAACCCTTTGCCCTCACATGG - Intronic
1108047163 13:46394168-46394190 AGGATCCCTGTACCTACACTGGG - Intronic
1108488139 13:50949202-50949224 AGGAACTCTGTTCCAACAGATGG + Intronic
1111374030 13:87354715-87354737 AGGACCCCTGATCCCCCACAGGG - Intergenic
1112826381 13:103397284-103397306 AGGACCCCTGTGCCAGTGGAGGG - Intergenic
1113511017 13:110854953-110854975 AGGACCCCAGTGCCAGTGCACGG - Intergenic
1113525429 13:110971229-110971251 AGGAACCCTGTGTCCTCACATGG + Intergenic
1113657591 13:112078134-112078156 GGGATCCCAGAGCCAACACAGGG + Intergenic
1114339024 14:21723761-21723783 AGCAACCCTGTGTCAGCACAGGG - Intergenic
1115133655 14:30083671-30083693 AGAACCCCTGTGCCAGGTCATGG - Intronic
1115909419 14:38239166-38239188 AGGAATCCTGAGTCAACACATGG + Intergenic
1118369565 14:65125849-65125871 AGGACACCTGTGCCAGTGCAGGG + Intergenic
1119789582 14:77337967-77337989 AGATCCCCTGGGCCAAGACAGGG - Exonic
1121690390 14:95874161-95874183 ATGATCCCTGTGGCCACACAGGG - Intergenic
1121824343 14:96998408-96998430 AGGACCACTGTGACACCACAAGG - Intergenic
1122301192 14:100732060-100732082 CGGCCCCCTGTGCCAACAACAGG + Exonic
1122663389 14:103312443-103312465 GGGACGCCTGTGCCACCACTGGG - Intergenic
1124425552 15:29559728-29559750 AGGACCCCTGTGATTACACAGGG + Intronic
1125135235 15:36333476-36333498 GGGACCGCTGTTCCAACTCAAGG + Intergenic
1125135927 15:36342688-36342710 AAGGCCACTCTGCCAACACATGG + Intergenic
1126051862 15:44693504-44693526 AGGACCCCTGTGATTACACTGGG + Intronic
1128390996 15:67182456-67182478 AGGAACCCTTTGCCAACCCTTGG - Intronic
1132024240 15:98391417-98391439 ACACCCACTGTGCCAACACAGGG - Intergenic
1132288283 15:100681697-100681719 AGGGCCCATTTCCCAACACAGGG + Intergenic
1133715211 16:8441035-8441057 AGGAGCCCACAGCCAACACATGG + Intergenic
1135624173 16:23981344-23981366 AGGACCCCTGTGATCACACTGGG + Intronic
1136626071 16:31462874-31462896 AGGACCCCTGAGCGGGCACAGGG + Exonic
1142248239 16:88979452-88979474 AGGGCCCCTCTGCCCACCCAGGG - Intergenic
1144665654 17:17100460-17100482 GGGACCCCTGAGCCAACAGATGG - Intronic
1146515237 17:33483913-33483935 AGGACCCCTGTGATACCACTGGG - Intronic
1149305166 17:55340331-55340353 AGGAGCCCTCTGCTAACCCAAGG - Intergenic
1149517372 17:57290853-57290875 AGGGCCCCCGTGTCATCACAAGG + Intronic
1155843406 18:30674928-30674950 AGGACCCCTGTGACTACATTGGG + Intergenic
1157623080 18:49027185-49027207 TGGACCCCAGTGCCGACTCAGGG - Intergenic
1160090832 18:75825270-75825292 AGCACCACTGTGCAAAAACAAGG + Intergenic
1161103195 19:2431523-2431545 AGGACCCCTGTGCCCACTTGCGG - Intronic
1161684604 19:5696571-5696593 AGGATCCCCGAGCCAACTCAGGG - Intronic
1162416178 19:10539269-10539291 AAGACCCCTGGGCCTACACTGGG + Intergenic
1166168068 19:41006435-41006457 TGGGCCCCTGTGCCCACCCAGGG + Intronic
1167880502 19:52453655-52453677 AGAACCCCTCCGCCAACACCAGG - Intronic
925959169 2:8999183-8999205 ATGACCCCTGTCCCTAAACATGG + Intronic
926666298 2:15527529-15527551 AGGAACACTGTGCCCTCACATGG + Intronic
927707730 2:25307245-25307267 AGGACTCCTGTGCCAAGCCCAGG + Intronic
931373793 2:61689084-61689106 GGGACCCCTCTGACATCACAGGG + Intergenic
932401944 2:71486698-71486720 AGGACCCCTGAGCCAACTTCAGG + Intronic
932558656 2:72848052-72848074 AGGACCCCTGTGATTACACTGGG + Intergenic
932988362 2:76755859-76755881 AGGTCCCCTGGGCCAAAAGAAGG - Intronic
935687468 2:105697012-105697034 AGGCCCCCTGTGCCTTCACATGG + Intergenic
936167058 2:110130041-110130063 AGGAACACTGTGCCATCACGTGG + Intronic
938277364 2:130038088-130038110 GGGACGCCGGTGCCACCACAAGG - Intergenic
938328335 2:130428891-130428913 GGGACGCCGGTGCCACCACAAGG - Intergenic
938361612 2:130692603-130692625 GGGACGCCGGTGCCACCACAAGG + Intergenic
938438020 2:131299292-131299314 GGGACGCCGGTGCCACCACAAGG + Intronic
941413280 2:165186958-165186980 AGCACCCCTGTCCCAACCCTAGG - Intronic
942327492 2:174788213-174788235 AAGACCCCTGTGGCTACTCAGGG + Intergenic
947752926 2:232542068-232542090 AGGACCCCCGTGTCTACAGAGGG - Intronic
947891349 2:233623921-233623943 AGGACCCCTGTGGATGCACATGG - Intronic
948242496 2:236449263-236449285 GGGAACTCTGAGCCAACACATGG + Intronic
948288795 2:236808730-236808752 AGGATTGCTGTGCCAACAGAGGG - Intergenic
948759121 2:240179618-240179640 AGGGGCCCTGGGCCAGCACAAGG + Intergenic
1169495717 20:6113055-6113077 TGGGCCCCTCTGACAACACATGG - Intronic
1172004746 20:31811369-31811391 AGGACCACTGTGCCAGGAGAGGG + Intergenic
1172117542 20:32581748-32581770 AGCACCCCAGTGCCCGCACAAGG + Intronic
1173052321 20:39575420-39575442 AGGACCCCTGTGATTACACTGGG - Intergenic
1173865701 20:46311441-46311463 ATGTCCCCTGTGCCAAGACAGGG - Intergenic
1173880099 20:46405944-46405966 AGGGCCCCTGTGCCTGCGCAGGG + Intronic
1174073008 20:47912038-47912060 AGGACCCCTGTGATTACACTGGG + Intergenic
1174151054 20:48486603-48486625 AGGACCCCTGTGATTACACTGGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1177327939 21:19616681-19616703 AGGAACCCTGTGTCCTCACATGG - Intergenic
1179131351 21:38639955-38639977 AGGAGCCCTGTGCTCACAGATGG - Intronic
1180895737 22:19330983-19331005 AGGAAAGCTGTTCCAACACACGG - Exonic
1182757086 22:32688930-32688952 AAGGCCCCAGTGCTAACACAAGG - Intronic
1184435809 22:44474667-44474689 AGGAACCCTGTGGCCTCACATGG - Intergenic
1185196041 22:49470119-49470141 AGGTCCCCTGTGGCAACACAGGG - Intronic
1185382993 22:50518693-50518715 AGGAGCCCTGTCCCAGCACTCGG + Exonic
952234078 3:31461101-31461123 AGGATCCCTGTGACTACACTGGG - Intergenic
952750083 3:36817833-36817855 GGGACCCCTGGGACAACAGAGGG - Intergenic
953918273 3:46934631-46934653 AGGTGCCCGGTGCCAGCACATGG + Intronic
954380153 3:50215044-50215066 AGGACACGTGTGCCCACACAAGG - Intronic
954415475 3:50391291-50391313 AGGGCCTCAGTGCCAACACCAGG - Intronic
954630215 3:52043959-52043981 AGGACACCTGGCCCAGCACAAGG + Intergenic
956102144 3:65779665-65779687 AGTTCTCCTGTGGCAACACAAGG + Intronic
959073451 3:101725240-101725262 AGGACCCGTGTGCAAGAACAAGG - Intronic
959908002 3:111731689-111731711 AGGACCCCTGTGATTACACTGGG + Intronic
960359716 3:116697136-116697158 AGGACCCCTGTGATTACACTGGG - Intronic
960949611 3:122990707-122990729 AGGACCCCTGTGACCCCACAGGG + Intronic
961317401 3:126050017-126050039 AGGACCCCTGTGGTTACACTGGG + Intronic
963639305 3:147838846-147838868 AGGAACACTGTGCCCTCACATGG - Intergenic
965914102 3:173819937-173819959 AGGAAGCCTGTGCAAGCACATGG - Intronic
968253844 3:197247492-197247514 AGGTCCCTGCTGCCAACACAGGG + Intronic
968574263 4:1357726-1357748 AGCACTCCTGAGCCCACACACGG - Intronic
969364460 4:6686048-6686070 AGGAGCCCTGTGAAAACACGGGG - Intergenic
970250049 4:14104883-14104905 ATCACCCCAGTGCCAACACCAGG - Intergenic
975860587 4:78672598-78672620 AGGACCGCTGAGCCTACCCAGGG - Intergenic
976333951 4:83864171-83864193 AGTATCACTGTGCCAACACCAGG - Intergenic
976894881 4:90097360-90097382 AGGAGCACTGTGCCTTCACATGG + Intergenic
980999727 4:139817288-139817310 GTGACCCCTGAGCCAACAAATGG - Intronic
982156817 4:152531596-152531618 AGCACTACTGTGCCTACACAGGG + Intronic
982438210 4:155401817-155401839 TGGACCCCTGTGACTACACTGGG - Intergenic
982849562 4:160295693-160295715 AGGGTCCCTGTAGCAACACAAGG - Intergenic
986609502 5:9552575-9552597 AGGAACACTGTGTCCACACATGG + Intergenic
986633549 5:9798209-9798231 AGGAGCCCTCTCCCAACTCAAGG - Intergenic
986801994 5:11270609-11270631 AGGATCCCTGCTTCAACACATGG + Intronic
991620301 5:68538677-68538699 AGGAGCCCTGTGGTGACACAAGG - Intergenic
992369449 5:76127762-76127784 AGGACCCCTCAGCCAACAGTTGG + Intronic
993278858 5:85898622-85898644 AGGTCCCCCGTGCCAAAACTTGG - Intergenic
999103736 5:149050192-149050214 AGAACCCCTGTGCCCACAGTGGG + Intronic
1000244282 5:159436507-159436529 AGGGCCCCTCCTCCAACACAGGG - Intergenic
1002834619 6:855699-855721 AGGACTCCTGAGCCCACACAAGG - Intergenic
1003878372 6:10458287-10458309 AGGTCCCCAGGGCCAAGACAAGG + Intergenic
1005111513 6:22286679-22286701 AGGTCCTTTGAGCCAACACAGGG + Intergenic
1006789075 6:36686801-36686823 AGGGGGCCTGTGCCACCACATGG - Exonic
1007827434 6:44611213-44611235 AGGGCCCTTGTGCTAACACAAGG + Intergenic
1008872929 6:56292627-56292649 AGTAGCTCAGTGCCAACACATGG + Intronic
1012100398 6:95077695-95077717 AGGCCCCCTGTGGCTAGACATGG - Intergenic
1013576428 6:111487397-111487419 AGGCCTCTTGTTCCAACACAGGG + Intergenic
1013839311 6:114371426-114371448 ATGACACGTGTGCCAAAACAAGG + Intergenic
1015272564 6:131352504-131352526 AGGGCCACTGAGCCATCACAAGG - Intergenic
1015446906 6:133316837-133316859 AGCACCTCTCGGCCAACACAAGG - Intronic
1016699143 6:147034137-147034159 AGGACACCTGGCCCAACACTGGG + Intergenic
1017519825 6:155192045-155192067 AAGACCCCTGTGACTACACTGGG - Intronic
1018617877 6:165705036-165705058 ACGAGCCCTGTTCCCACACAGGG + Intronic
1019502289 7:1370255-1370277 AGGGCCTCTCTGCCCACACAGGG - Intergenic
1021710263 7:23409236-23409258 GGGACCCCTGTGCTACAACATGG + Intronic
1023760891 7:43464265-43464287 AGGAGCCATGTGACAACACTAGG + Intronic
1023979635 7:45061155-45061177 AGGACCCCTGTGTAATAACAGGG - Intronic
1024474748 7:49798590-49798612 AGGACCCTCATTCCAACACAGGG - Intronic
1032359797 7:131244748-131244770 AGGACCCCTGTGCCAACACAGGG - Intronic
1035541756 8:445417-445439 AGGACCCCTGAGACAACATTTGG - Intronic
1035678011 8:1468526-1468548 ACCACACCTGTTCCAACACATGG + Intergenic
1037876358 8:22550861-22550883 GGGATCCCTGAGCCAACTCAAGG + Intronic
1038060197 8:23904055-23904077 AGGACAACTGAGGCAACACAAGG - Intergenic
1038424420 8:27455215-27455237 GGGATCCCTGTGACAACACTGGG - Intronic
1040665731 8:49630404-49630426 AGGAAAACAGTGCCAACACAGGG + Intergenic
1049009800 8:139879652-139879674 AGGACAGCAGGGCCAACACAGGG - Intronic
1055619075 9:78104851-78104873 ATGACCCATGTCCCAACACCAGG - Intergenic
1055792506 9:79937778-79937800 AGGACCCCTGTGACTACATTGGG - Intergenic
1056220699 9:84448265-84448287 AGGACCCCTGTGATGACACTGGG - Intergenic
1056825172 9:89872240-89872262 AGGAGCCCTGGGCCAACGCCTGG + Intergenic
1057168840 9:92948789-92948811 ACCACCCCTGCCCCAACACAAGG - Intronic
1057572137 9:96212560-96212582 TGGACCTCTGGGCTAACACAGGG + Intergenic
1057868916 9:98703170-98703192 AGGCCATCTGTGCCACCACATGG + Intronic
1060210470 9:121707056-121707078 AGGCCTCCTAAGCCAACACAGGG - Intronic
1061230481 9:129312939-129312961 AGGGCCCCACAGCCAACACATGG - Intergenic
1061485285 9:130917511-130917533 AGGCCCCATCTGACAACACAGGG - Intronic
1062254533 9:135614786-135614808 AGGACCCCAGGGGCCACACAGGG - Intergenic
1062521422 9:136959490-136959512 AGGCCCCCTCTGCCACCGCAGGG - Intergenic
1186145246 X:6618141-6618163 AGGACCCTTGTGATGACACAGGG - Intergenic
1186951512 X:14630912-14630934 AGGAACACTGTGCCCTCACATGG + Intronic
1194819720 X:98490839-98490861 AGGAGCTCTGTGCCAGGACAGGG - Intergenic
1198039562 X:132836426-132836448 GGGGCCCCTGTGCCCACAAATGG + Intronic
1198706324 X:139452344-139452366 AGGACCCCTCTACCAAGCCAGGG - Intergenic