ID: 1032360781

View in Genome Browser
Species Human (GRCh38)
Location 7:131252798-131252820
Sequence CTTGGCATGCACAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032360774_1032360781 22 Left 1032360774 7:131252753-131252775 CCTGGTCAAGTGGTTTATTTTGA 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 303
1032360773_1032360781 29 Left 1032360773 7:131252746-131252768 CCTGATTCCTGGTCAAGTGGTTT 0: 1
1: 0
2: 3
3: 14
4: 160
Right 1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG 0: 1
1: 0
2: 0
3: 15
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032360781 Original CRISPR CTTGGCATGCACAAGGGGGA TGG Intronic
900609195 1:3537282-3537304 CCTGGCATGAAACAGGGGGAAGG + Intronic
900645822 1:3708284-3708306 ATTGGCATGCACCAAGGAGATGG + Intronic
900660529 1:3780001-3780023 CTTGGCATGTGCAAGGGCGTTGG - Exonic
904748419 1:32725507-32725529 CTTGGCCTGCAAGATGGGGATGG + Intergenic
906433119 1:45772228-45772250 CTTGGGAAGCCCAAGGTGGATGG - Intergenic
907926336 1:58958326-58958348 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
908182391 1:61618883-61618905 ATGGGCAGGCAGAAGGGGGAGGG + Intergenic
908898070 1:68923683-68923705 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
910797967 1:91117619-91117641 TTTGGCATGCTCAGGGGAGAAGG - Intergenic
911291100 1:96057514-96057536 CTTGGGAAGCACAAGGGGTGAGG - Intergenic
912218086 1:107639699-107639721 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
912462984 1:109849434-109849456 ATTGGCAGGCCCAAGGGAGAAGG - Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
915735447 1:158081818-158081840 CTTTGCATGAACAAAGGGGCAGG + Intronic
915808946 1:158886300-158886322 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
915814615 1:158952937-158952959 CTTGGGAAGCACAAGGGTCAGGG + Intronic
915962911 1:160282133-160282155 CTAGGCATGGACGAAGGGGATGG - Exonic
919375348 1:196786738-196786760 CTTGGGAGGCACAAGGGGTCAGG - Intronic
921547090 1:216485836-216485858 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
922987552 1:229877640-229877662 GTTGGGGTGCACAAGGGAGAGGG + Intergenic
924492845 1:244556088-244556110 CTTGGAATGCTGAAGTGGGAAGG + Intronic
1063306982 10:4911353-4911375 CATGCCATGTGCAAGGGGGAGGG + Intergenic
1063307465 10:4918364-4918386 CATGCCATGTGCAAGGGGGAGGG - Intergenic
1063942718 10:11147108-11147130 CCTGGCAGGCACAAGGGAGTGGG - Intronic
1066992793 10:42532004-42532026 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1068340033 10:55688875-55688897 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1068355056 10:55899836-55899858 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1070464290 10:76703934-76703956 CTTTGCTTGCAGAAAGGGGAGGG + Intergenic
1071381103 10:85061048-85061070 CTTGGCATGGACCTCGGGGAAGG + Intergenic
1071982801 10:91020667-91020689 CTTGGCATGTGCAATTGGGATGG + Intergenic
1073381406 10:103080577-103080599 GTTGGCATCCCCAAGTGGGAGGG + Exonic
1075841603 10:125509351-125509373 CTTTCCATTCACAATGGGGAAGG + Intergenic
1076429253 10:130390176-130390198 CATGGCATGAACATGGGGAAAGG - Intergenic
1076519888 10:131074941-131074963 ATTGGGATGAACCAGGGGGAGGG + Intergenic
1077251849 11:1564252-1564274 CATGCCATGCACATGGGTGAAGG + Intronic
1077374312 11:2198390-2198412 CTTGGCATGCACGTCGGGGTGGG + Intergenic
1077794514 11:5477695-5477717 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1078021958 11:7663956-7663978 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1079286183 11:19135255-19135277 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1080705936 11:34692624-34692646 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1080968902 11:37246499-37246521 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1081443034 11:43100932-43100954 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1082060733 11:47857923-47857945 CTTGGCAGGCAAAATGAGGAAGG - Intergenic
1082623870 11:55460111-55460133 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1083173616 11:60936575-60936597 CCTGGCCCGCCCAAGGGGGAGGG + Exonic
1083431407 11:62615373-62615395 CTGGGCATGCACTGGGGGGCTGG - Exonic
1083521040 11:63313189-63313211 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1083964015 11:66031752-66031774 CTTGGGAGGCTAAAGGGGGAGGG - Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086175251 11:83884150-83884172 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1087608780 11:100409248-100409270 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1087869475 11:103274249-103274271 CTTTGCATGGTCAAGGTGGAAGG + Intronic
1089240919 11:117078358-117078380 CGTGTCATGCACAAGGTGGGAGG + Intronic
1089614254 11:119686372-119686394 GTTGGCCTGGACAAGGGGCAAGG - Intronic
1089661354 11:119987907-119987929 CTTGCCATGCACATTGGGCAAGG - Intergenic
1089816247 11:121178112-121178134 CTTGGGAAGCACAAGGGGTCAGG - Intronic
1091640069 12:2229762-2229784 CCTGGCAGGCTCAAGGGCGAGGG + Intronic
1093776175 12:23076436-23076458 CTTGGAAAGCACAAGGGGTCAGG - Intergenic
1094805168 12:34083438-34083460 CCTGGGAAGCACAAGGGGGCAGG + Intergenic
1095833995 12:46617689-46617711 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1096030392 12:48409105-48409127 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1097506208 12:60474915-60474937 CTAGCCATGCAAAAGGGTGAGGG - Intergenic
1098291799 12:68963602-68963624 GTTGTCAGGCACTAGGGGGATGG - Intronic
1098494437 12:71118268-71118290 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1099022599 12:77424811-77424833 CCTGGGAAGCACAAGGGGTAAGG - Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1101090639 12:101281515-101281537 CTTGGAATGCATAAGGGAAAGGG - Intronic
1101495051 12:105245997-105246019 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1103472990 12:121196850-121196872 CTTGGGATGGACAAGGGGAGGGG - Intergenic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1104210756 12:126685977-126685999 TTTGGGATGCAGAAGGGAGAGGG - Intergenic
1106197769 13:27508978-27509000 CTTCGCCTGCACAGAGGGGAGGG + Intergenic
1106216622 13:27707541-27707563 GTAGGCATGAACAAGGGGAAGGG + Intergenic
1107155010 13:37155766-37155788 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1108955656 13:56154458-56154480 CTTTGCATGCAATCGGGGGATGG - Intergenic
1109270652 13:60251832-60251854 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1111701812 13:91699310-91699332 CTTGGCTGCCACAAGGTGGAAGG + Intronic
1113062496 13:106338241-106338263 ATTAGAATGCACAAGGGGAATGG - Intergenic
1113309535 13:109117298-109117320 CTTGAAATGCACAAGTGGCAGGG - Intronic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113945424 13:114041254-114041276 CTTGGGAGGCCCAGGGGGGAGGG + Intronic
1114751598 14:25210346-25210368 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1114982908 14:28188637-28188659 CTTGGGAAGCACAAGGGGTCGGG + Intergenic
1114993583 14:28318311-28318333 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1115743182 14:36409597-36409619 CCTGGCAAGCACAAGGGGTCAGG + Intergenic
1116675474 14:47901376-47901398 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1118456939 14:65953211-65953233 CATGGCAGGAACAAGGGGCAGGG - Intergenic
1118655314 14:67941086-67941108 CTTGGAATCCACAAGTAGGAGGG + Intronic
1119400558 14:74359570-74359592 CCTGGCATCCCCAAGGGAGAAGG + Exonic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122416731 14:101553414-101553436 TCTGGCTTGCACAATGGGGAGGG - Intergenic
1122980712 14:105191294-105191316 CTAGGCATGCACAGAGGGGCCGG - Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1129821830 15:78607780-78607802 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1129967603 15:79750896-79750918 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1130187364 15:81697359-81697381 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1130198567 15:81804450-81804472 CTTGTCAAACACAAGTGGGAGGG - Intergenic
1130714155 15:86315101-86315123 CTTGCAATGAACAAGGAGGATGG - Intronic
1130978184 15:88793105-88793127 CTTGGCATGCAGAGGGGGCAGGG + Intergenic
1132269136 15:100507681-100507703 TTTGGCATTCACAATGGGAAAGG - Intronic
1133315801 16:4883282-4883304 CTTGGCCTGCACCAGGGCAAGGG + Exonic
1133317845 16:4895111-4895133 GTTGGCCTGCACCAGGGGAAGGG + Intronic
1135107386 16:19662093-19662115 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1136917399 16:34218655-34218677 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1137081898 16:36072119-36072141 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1141617699 16:85219746-85219768 TGTGGCTTGCAGAAGGGGGAAGG - Intergenic
1141731345 16:85825075-85825097 ATTTGCAGGCACCAGGGGGACGG - Intergenic
1141801586 16:86313214-86313236 CTTGCCATGCACAAGCGTGCAGG + Intergenic
1145997530 17:29113219-29113241 CTTGGCTTGCACAAGTGGTGGGG - Intronic
1151421144 17:73998795-73998817 CTGGGCTTCCACAAGGGGGCAGG - Intergenic
1152615476 17:81335981-81336003 CTGGGCATGCTCAAGGAGGGCGG - Intergenic
1152617526 17:81344927-81344949 TTTGACGTGCACATGGGGGAGGG + Intergenic
1154011458 18:10578462-10578484 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1154499607 18:14988745-14988767 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1155339068 18:24795858-24795880 GTTGGCATGAAGTAGGGGGAGGG - Intergenic
1155343026 18:24831764-24831786 CTTGGCACGCAGGAGGGGGTTGG + Intergenic
1158853086 18:61515309-61515331 CTTGGGAAGCACAAGGGGTCAGG - Intronic
1159375521 18:67587295-67587317 ATTGGCATGTACAAGATGGAAGG - Intergenic
1161523137 19:4736895-4736917 CTTGGCCTCCCAAAGGGGGACGG - Intergenic
1164933884 19:32196426-32196448 CTTGGCAGTGACAATGGGGAGGG - Intergenic
1165003790 19:32787874-32787896 CCTGGGAAGCACAAGGGGAAAGG - Intronic
1166102269 19:40577631-40577653 GTTGGCATGGAAAAAGGGGAGGG + Intronic
925342984 2:3149553-3149575 CTGGGCATGCCCACGGGGGCCGG - Intergenic
926867505 2:17375895-17375917 CTTGGGATGCGCATTGGGGAAGG - Intergenic
926893232 2:17657156-17657178 CTCAACATGCACAAGGGTGAAGG - Intergenic
926929042 2:18017806-18017828 CTTGGGAAGCACAAGGGGTCAGG - Intronic
929796730 2:45065369-45065391 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
929864911 2:45709570-45709592 CTTGGAATCCAGAATGGGGATGG - Intronic
930317713 2:49817578-49817600 TTTTCCATGGACAAGGGGGAGGG - Intergenic
930503069 2:52247477-52247499 CTTGTCCTTCACAAGGGGGCAGG - Intergenic
930720003 2:54629560-54629582 CTCGGCATGCTCCTGGGGGAGGG - Exonic
930972883 2:57418904-57418926 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
933186820 2:79288056-79288078 CTTGGCAAGCGCAAGGGGTCAGG - Intronic
934518830 2:95006726-95006748 CTTGGCATTCAAAGGGGTGAGGG + Intergenic
935666339 2:105516209-105516231 CTTGGCCAGCACAAGTGGTATGG - Intergenic
935677620 2:105609476-105609498 CTTGGGATGCACAGGGCAGAGGG - Intergenic
937489648 2:122352096-122352118 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
937925272 2:127162970-127162992 CTGGGCTTGCACAAGGGCTAGGG - Intergenic
938534882 2:132231522-132231544 CTTGGGAAGCACAAGGGGTCAGG + Intronic
939059136 2:137398973-137398995 CTTGGGAAGCACAAGGGGTCAGG - Intronic
940246323 2:151620943-151620965 CTTGGCAGCCACAATGGGAATGG + Exonic
940246987 2:151629563-151629585 CTTGGCAGCCACGATGGGGATGG + Exonic
942277039 2:174330851-174330873 CCTGCCATGAACAAGGGAGAAGG - Intergenic
942369718 2:175270570-175270592 CTTGGAATTCACAAGGGACAGGG + Intergenic
946116758 2:217469534-217469556 CTTGGCACCCAGAAGGGGAAAGG + Intronic
948316034 2:237029164-237029186 CTTGGCTTGGACAGGGAGGAGGG - Intergenic
948328316 2:237144297-237144319 CTTGGAATGAAGAAGTGGGATGG - Intergenic
948672234 2:239575944-239575966 CTTGGCATCCACAGGAGGTAGGG + Intergenic
1168910566 20:1443652-1443674 CTGGGTGTGCACAAGGGGGCAGG + Exonic
1169516460 20:6321628-6321650 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1172652350 20:36512814-36512836 CTTGACATGCGCAAGGCTGAGGG + Intronic
1173185307 20:40835940-40835962 CCTGGCATGGAGAAGGGTGATGG + Intergenic
1173301436 20:41807189-41807211 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1175343818 20:58254821-58254843 CTGGGCATGCACAGGGGAGATGG + Intergenic
1175512224 20:59537586-59537608 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1175616640 20:60405359-60405381 TTTGGAATGGAGAAGGGGGAAGG + Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1177631673 21:23736469-23736491 CATGACAAGCACAAGGTGGAGGG + Intergenic
1179323448 21:40315889-40315911 ATTGGCAAGCAAAAGGAGGAGGG + Intronic
1180519471 22:16183915-16183937 CTTGGGAAGCGCAAGGGGTAAGG + Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1185075640 22:48680654-48680676 CCTGGCATGCACAAGGGGCCTGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950396303 3:12736725-12736747 TGGGGAATGCACAAGGGGGATGG - Intronic
951321952 3:21255538-21255560 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
951347652 3:21565484-21565506 CTTGGGAGGCTCAAGTGGGAGGG - Intronic
952472564 3:33671649-33671671 CTTGGGAAGCACAAGGGGTCAGG + Intronic
952902475 3:38119363-38119385 CTGGGCATGAGCAAGGGGGCTGG - Intronic
954984413 3:54776860-54776882 CTCGGAAGGCACAAGGGAGAGGG - Intronic
955539732 3:59961673-59961695 CTTGGGAAGCACAAGGGGTCAGG - Intronic
958102677 3:89034712-89034734 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
960715753 3:120573211-120573233 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
962180396 3:133200196-133200218 CCTGGTAAGCACAAGGGGTAAGG - Intronic
962423235 3:135246424-135246446 CTTGGCATGCAACAAGGGCATGG - Intronic
963954795 3:151241956-151241978 CTTGGGAAGCACAAGGGGTCAGG + Intronic
964399551 3:156284775-156284797 CTTGGGAAGCACAAGGGGTCAGG - Intronic
964602493 3:158516905-158516927 CTTGGGAAGCACAAGGGGTCAGG - Intronic
966437856 3:179908616-179908638 CTTGTCATGGAGTAGGGGGAGGG - Intronic
969236881 4:5871571-5871593 AATGGCATGAACAAGGGAGAAGG + Intronic
970020023 4:11557641-11557663 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
970638747 4:18039711-18039733 CTTGGCAAGCACTGTGGGGATGG + Intergenic
972995936 4:44879656-44879678 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
973124504 4:46567318-46567340 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
973889718 4:55356936-55356958 ATTGGCATGGCCAAGGGCGAGGG - Intronic
974493861 4:62602472-62602494 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
974945019 4:68515614-68515636 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
974981535 4:68963699-68963721 CTTGGAATGCAGAAGAGGCAAGG - Intergenic
975662200 4:76699028-76699050 CATGGCCTGCATAAGGGAGATGG - Intronic
976371846 4:84298974-84298996 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
976870579 4:89788498-89788520 CATGGCAAGAACAAGGGGGAAGG + Intronic
977057392 4:92211041-92211063 CCTGGCAAGCACAAGGGGTCAGG + Intergenic
977815703 4:101411477-101411499 CTTGGGAAGCACAAGGGGTCAGG - Intronic
978834154 4:113127653-113127675 CTTGGCATGATCAAAGTGGAAGG + Intronic
979027153 4:115592159-115592181 CTTTGCATCCACAAGGAGGAGGG + Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
981772281 4:148323688-148323710 CTTGGGAAGCACAAGGGGTCAGG - Intronic
982581207 4:157180699-157180721 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
982651252 4:158090052-158090074 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
983167765 4:164497982-164498004 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
983687759 4:170431579-170431601 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
984857627 4:184208422-184208444 CTTGGGAAGCACAAGGGGTCAGG + Intronic
988253940 5:28798987-28799009 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
989965191 5:50458797-50458819 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
990641016 5:57783577-57783599 CTTAGAATGGACAAGGGAGAGGG + Intergenic
991241969 5:64470704-64470726 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
991242654 5:64477291-64477313 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
993577600 5:89621723-89621745 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
993790268 5:92199277-92199299 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
995343967 5:111090691-111090713 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
995676732 5:114671067-114671089 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
997087402 5:130817931-130817953 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
997793922 5:136788611-136788633 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
999091798 5:148942457-148942479 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1000076038 5:157787729-157787751 CTTGACAGGCACAATGGGAATGG - Exonic
1000334485 5:160231986-160232008 CCTATCATGCACAAGGGGGTAGG + Intronic
1001254103 5:170170647-170170669 CTTGGTATGCCCATGGGAGAGGG - Intergenic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1002641682 5:180633463-180633485 CTTGGCACCCCCAAGGGGAAGGG - Intronic
1002673131 5:180886355-180886377 CCTGGGAAGCACAAGGGGCAGGG - Intergenic
1003513820 6:6802558-6802580 CTTGGCTTCCACAAGGGTGCTGG + Intergenic
1004802316 6:19163263-19163285 CTTGCCATGAACATGGGGCAAGG - Intergenic
1005667051 6:28068357-28068379 CCTGGGAGGCACAAGGGTGAGGG - Intergenic
1008212032 6:48737540-48737562 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1010460755 6:76111424-76111446 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1010834873 6:80573728-80573750 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1011550445 6:88527132-88527154 CTTGGTAAGCACAAGGGGTCAGG - Intergenic
1012956577 6:105576995-105577017 CTTGGCATGGACAATTGGAATGG - Intergenic
1013735849 6:113226682-113226704 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1013902527 6:115175421-115175443 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1014156039 6:118110864-118110886 CTTGCCTTCCACAAGGGGGAAGG - Intronic
1016007485 6:139104628-139104650 CTTGGCATACCCAAGGAGGGTGG - Intergenic
1016239815 6:141917054-141917076 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1017544673 6:155438275-155438297 CTTGGGATGGGCAAGGTGGATGG - Intronic
1018115490 6:160579626-160579648 CTTGGGAGGCATAATGGGGAAGG - Intronic
1018181713 6:161228813-161228835 CTTGGCATGCTGAAGGAGGAAGG - Intronic
1018452392 6:163921319-163921341 CTTGTCATGCAGAGGTGGGATGG + Intergenic
1018918577 6:168154697-168154719 GTGGGCATGCACAAGGCAGAAGG + Intergenic
1018948881 6:168365469-168365491 CTTGGCCTGCAGAGAGGGGAGGG + Intergenic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1020905054 7:14053715-14053737 ATTGGTATCTACAAGGGGGAAGG - Intergenic
1021302636 7:18990853-18990875 CTTGGGAAGCACAAGGGGCCAGG - Intronic
1021373907 7:19883577-19883599 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1023494072 7:40776008-40776030 AGTGGCAGGCACAATGGGGAAGG - Intronic
1023697843 7:42865689-42865711 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1023717556 7:43059290-43059312 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1024041772 7:45561531-45561553 CTTGGCATGCTCAAGGGCACAGG + Intergenic
1025116092 7:56259751-56259773 CCTAGCATGTACAAGTGGGAAGG - Intergenic
1026837130 7:73646906-73646928 CTGGGCCTTCACAAGGGGGATGG - Intergenic
1027582793 7:80020006-80020028 CCTGGGAAGCACAAGGGGTAGGG + Intergenic
1027982935 7:85250051-85250073 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1028062489 7:86340402-86340424 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1028467951 7:91173639-91173661 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031030011 7:116724277-116724299 CTTGGGAAGCACAAGGGGTCAGG - Intronic
1031266306 7:119586906-119586928 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1031457937 7:122007316-122007338 CTTGGCACTGCCAAGGGGGAGGG + Intronic
1031477281 7:122238717-122238739 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1031891910 7:127304245-127304267 CTTGGCATTTAAAAGGGGGCAGG - Intergenic
1032360781 7:131252798-131252820 CTTGGCATGCACAAGGGGGATGG + Intronic
1032993908 7:137424595-137424617 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1034545713 7:151787376-151787398 GTTGCCAAGCACTAGGGGGAGGG - Intronic
1034886218 7:154801053-154801075 CTTGGCGTGCACATGGGGCTGGG + Intronic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1039388894 8:37161277-37161299 CTTGGCTTGCCCAAGGGGACTGG + Intergenic
1040083485 8:43313091-43313113 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1040090815 8:43396867-43396889 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1040449581 8:47531016-47531038 CTTGGAATGCTTAAGTGGGAGGG - Intronic
1041637509 8:60160560-60160582 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1042087067 8:65120835-65120857 CTTGGGAAGCACAAGGGTCAGGG + Intergenic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042682922 8:71406557-71406579 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1042779887 8:72479630-72479652 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1042912361 8:73840671-73840693 TTTGGTATGCAAAAGGGGCAGGG - Intronic
1044191679 8:89326453-89326475 TTTGACAAGGACAAGGGGGAAGG - Intergenic
1045540640 8:103081030-103081052 TGTGGCATGCAGAAGGGGCAGGG - Intergenic
1047016070 8:120724766-120724788 CTAGGCATGCAGGAGGGAGATGG + Intronic
1047579598 8:126199600-126199622 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1048626981 8:136196004-136196026 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1051349405 9:16184957-16184979 CTTGGTCTGCTCATGGGGGAGGG - Intergenic
1051537621 9:18178209-18178231 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1052650357 9:31294262-31294284 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1052701074 9:31938164-31938186 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1054943281 9:70767538-70767560 TTAGGCAGGCACAATGGGGATGG + Intronic
1057638823 9:96797200-96797222 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1057761772 9:97880523-97880545 CTTGGCAGGCAGAAGTGGGAAGG - Intergenic
1058516654 9:105782863-105782885 CTTGGGAAGCACAAGGGTCAGGG - Intergenic
1058557711 9:106187426-106187448 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1061082816 9:128382372-128382394 CTGGGCATGGACTTGGGGGAAGG - Intronic
1061644393 9:131988718-131988740 CTTGGGAGGCCAAAGGGGGAAGG - Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062443309 9:136583179-136583201 CTAGGCAGGCACAATGGGCATGG - Intergenic
1189750144 X:44212480-44212502 CTAGCCATCCACATGGGGGAAGG + Intronic
1190975511 X:55396711-55396733 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1191168608 X:57418490-57418512 CCTGGGATGCACAAGGGGTCAGG - Intronic
1191935834 X:66426450-66426472 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1192319400 X:70077347-70077369 ATTGGCAGGCCTAAGGGGGAGGG - Intergenic
1192598881 X:72440740-72440762 CTTGGGAAGCACAAGGGGTCAGG + Intronic
1192942265 X:75925213-75925235 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1192949167 X:75998065-75998087 CCTGGGAAGCACAAGGGGTAGGG - Intergenic
1193735034 X:85147027-85147049 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1193765960 X:85529403-85529425 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1193817277 X:86119130-86119152 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1193831611 X:86295227-86295249 CTTGGGAAGCACAAGGGGTCAGG - Intronic
1194021186 X:88694378-88694400 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1196833006 X:119791188-119791210 CGTGGCATGCGCAACGTGGAGGG - Intronic
1198430751 X:136564456-136564478 CTTTGCATGTAGAAAGGGGAGGG - Intergenic
1198675672 X:139127666-139127688 CTTGGCAGTCACAAGGGCTAAGG + Intronic
1199587916 X:149436011-149436033 CTTGGGAAGCACAAGGGGTCAGG + Intergenic
1199742493 X:150748719-150748741 CTTGGCAGGCTGAAGTGGGAGGG + Intronic
1201360025 Y:13136306-13136328 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1201418896 Y:13776515-13776537 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1201759393 Y:17520659-17520681 CTTGGGATGGTCAAGGGGCAAGG + Intergenic
1201842161 Y:18385331-18385353 CTTGGGATGGTCAAGGGGCAAGG - Intergenic
1201933429 Y:19379096-19379118 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1201969823 Y:19779861-19779883 CTTGGGATGCACAAGGGGTCAGG + Intergenic
1202383523 Y:24300223-24300245 CTTGGGAAGCACAAGGGGTCAGG - Intergenic
1202487261 Y:25369898-25369920 CTTGGGAAGCACAAGGGGTCAGG + Intergenic