ID: 1032362704

View in Genome Browser
Species Human (GRCh38)
Location 7:131271174-131271196
Sequence TGTAGGCCCCCTCCTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032362704_1032362712 12 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362712 7:131271209-131271231 GGTCAGGGAAGGCTTCACACAGG 0: 2
1: 3
2: 42
3: 254
4: 966
1032362704_1032362707 -4 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362707 7:131271193-131271215 TACATCTGCCTACCTAGGTCAGG No data
1032362704_1032362709 1 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362709 7:131271198-131271220 CTGCCTACCTAGGTCAGGGAAGG No data
1032362704_1032362713 15 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362713 7:131271212-131271234 CAGGGAAGGCTTCACACAGGAGG No data
1032362704_1032362708 -3 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362708 7:131271194-131271216 ACATCTGCCTACCTAGGTCAGGG No data
1032362704_1032362705 -9 Left 1032362704 7:131271174-131271196 CCAGGAAAAGGAGGGGGCCTACA 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1032362705 7:131271188-131271210 GGGCCTACATCTGCCTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032362704 Original CRISPR TGTAGGCCCCCTCCTTTTCC TGG (reversed) Intronic
900270325 1:1783680-1783702 TGTAGGCCCCCTCCTCCCCTGGG - Intergenic
900820372 1:4881963-4881985 TGTCGGCCCCCTGCTCTTTCTGG - Intergenic
901035566 1:6334031-6334053 TGCAGGCAACCTCCTCTTCCTGG + Intronic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
901878617 1:12181167-12181189 TGGAGGCCCCCTCCTTTGCAAGG + Intronic
901973166 1:12924353-12924375 TGAAGTCACCCTCCTTTTGCCGG + Intronic
902012014 1:13277410-13277432 TGAAGTCACCCTCCTTTTGCCGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904853987 1:33481700-33481722 TGTAGGCACCAACCTTTTTCAGG - Intronic
905891790 1:41522555-41522577 TGTAGGCCCTCCCCATTTCCAGG - Intronic
905969984 1:42134472-42134494 GGTATTCCCCCTCCTTTCCCTGG + Intergenic
907394491 1:54179702-54179724 TGTAGGCCAAATCCTTTGCCAGG + Intronic
910517553 1:88079242-88079264 CAAAGGCCCCCTCCTCTTCCTGG - Intergenic
912848918 1:113104320-113104342 TGTAGGCCCCCCACCCTTCCTGG + Intronic
913343001 1:117778777-117778799 TGAAGCCTCCCTCCCTTTCCAGG + Intergenic
918115595 1:181493983-181494005 TGAAGGCACCATCCTCTTCCAGG + Intronic
922894260 1:229088329-229088351 GGAAGGCACCCTCCTTTCCCTGG + Intergenic
923469788 1:234280228-234280250 GGTAGGCCCCCTCGTTTTGGGGG - Intronic
924145057 1:241065337-241065359 TGTAAGCCCACTCATTTGCCAGG - Intronic
1067583102 10:47457902-47457924 TGAAGGGCTCCTCCTTCTCCAGG + Intergenic
1074710491 10:116173251-116173273 TGTGGGACCACTGCTTTTCCTGG + Intronic
1075318130 10:121468356-121468378 TGTAGCCACCCCCCGTTTCCAGG - Intergenic
1075624320 10:123950848-123950870 AGTGGGCCCTCTCCTTGTCCAGG - Intergenic
1075995594 10:126873866-126873888 TCTAGGACCCCACCCTTTCCGGG + Intergenic
1078423177 11:11228878-11228900 TGGAGGCCTCCTCCCTTGCCTGG - Intergenic
1080891272 11:36410910-36410932 TGGAGGACCCCTGCTGTTCCTGG + Intronic
1083327054 11:61878251-61878273 TCCAGGCCACCTCCTTCTCCCGG + Intronic
1083484334 11:62973953-62973975 TGTAGCCACCCTCAGTTTCCTGG - Intronic
1085518486 11:77124770-77124792 TGTAAGACCCCAGCTTTTCCTGG + Exonic
1087044604 11:93834301-93834323 TACAGGCTCCCTCCTCTTCCTGG + Intronic
1087156924 11:94913922-94913944 GGTATGCCCCCTCCCATTCCAGG - Intergenic
1087932989 11:103999767-103999789 TGGAGGTCCTCTCCTTTTCCAGG - Intronic
1088977412 11:114828088-114828110 TCTAGGCCCAAACCTTTTCCAGG - Intergenic
1092252194 12:6905767-6905789 CCTAGGACCCCTCCTTGTCCAGG - Intronic
1096812783 12:54182398-54182420 TCTATGCCCTCTGCTTTTCCTGG - Exonic
1097053809 12:56238615-56238637 AGTAGGCACCCTCCCTTCCCAGG + Exonic
1097693577 12:62756363-62756385 TCTAGGCCCCTCCCTTTTCAGGG - Intronic
1100426249 12:94489669-94489691 TGAAGGCCACCATCTTTTCCTGG + Intergenic
1102698415 12:114817864-114817886 TGTAGGGCCCCCACTTTCCCAGG - Intergenic
1103322424 12:120099870-120099892 TGTGGTCCCCCTCCTCCTCCGGG - Intronic
1103471377 12:121184511-121184533 TGCAGGCCCCCGGCTTTTTCCGG - Exonic
1103941263 12:124502513-124502535 TGTAGACTCCCTCCTCTCCCCGG - Intronic
1103945223 12:124522530-124522552 TTTAGGGCCCATCCTATTCCAGG + Intronic
1104732956 12:131118686-131118708 AGCAGGCCCCCTGCTATTCCTGG - Intronic
1105771593 13:23617327-23617349 TGTGGTCCCTCTCCTTTCCCTGG - Intronic
1107960144 13:45550088-45550110 TGCAGGGCCCTACCTTTTCCAGG - Intronic
1109177435 13:59173714-59173736 TGAACTCCCCATCCTTTTCCTGG + Intergenic
1110753631 13:79145539-79145561 TGTAGGCACACTTCTTTTTCAGG - Intergenic
1113793951 13:113045980-113046002 TGTAGCCACCCTCCTTTCCAAGG + Intronic
1114408507 14:22478734-22478756 TATAGGTCCCCTCCCTTTTCGGG + Intergenic
1115692671 14:35860988-35861010 AGTTAGCCCCCTTCTTTTCCAGG + Intronic
1117060215 14:51954704-51954726 TGTCTGCCTCTTCCTTTTCCTGG + Intronic
1118592211 14:67410247-67410269 TGGAGGCCTTCTCCTGTTCCTGG - Intronic
1122330498 14:100909252-100909274 GGGAAGCCTCCTCCTTTTCCTGG + Intergenic
1123931384 15:25173337-25173359 GGTAGGCCCCCTCCCTGTGCAGG + Intergenic
1125765230 15:42131098-42131120 TGTAGGCCCCCTCTGTAGCCAGG + Intergenic
1126120707 15:45248783-45248805 GGCAGGCCACCTCATTTTCCAGG + Intergenic
1128648273 15:69392821-69392843 TGTAGTCCTCATCCTTGTCCTGG - Intronic
1129198899 15:73986936-73986958 TGTGGGCCCCCTGCTATCCCAGG - Intronic
1132054776 15:98642221-98642243 TGTAGGAACCAGCCTTTTCCAGG + Intergenic
1132127565 15:99241729-99241751 TGAAGGTCCCCTGCTTTTCCAGG + Intronic
1132200823 15:99953580-99953602 TGTAGCCCCTCTTCTTTTCTAGG + Intergenic
1133007585 16:2893226-2893248 TTCAGGCCCTCTCCCTTTCCTGG + Intronic
1133026023 16:2989323-2989345 TGGATGCCACCTCCCTTTCCAGG - Intergenic
1135049041 16:19177711-19177733 TGTGGGCCCCCAACTTTTCTTGG + Intronic
1135567704 16:23524597-23524619 CTTAGGACCCATCCTTTTCCAGG - Intronic
1137832157 16:51554228-51554250 TGTGGGACCCTTCCTTTTACTGG - Intergenic
1138256775 16:55571425-55571447 AGTGGGCCCCATCCCTTTCCTGG - Intronic
1143103593 17:4517234-4517256 TAGAGGCCCCCTCTGTTTCCAGG + Intronic
1143565936 17:7720623-7720645 TGTAGACCTCCTTCTTTACCTGG + Intronic
1147603051 17:41757700-41757722 CGTCGGCCGCCTCCTTGTCCTGG + Exonic
1148701497 17:49589630-49589652 AGCAGGCCCCCTCCTCTCCCAGG - Intergenic
1149452672 17:56762122-56762144 TATAGCCTCCCACCTTTTCCAGG + Intergenic
1150009499 17:61491040-61491062 TGTGTGCCTCCTCCTTTTCCAGG + Intergenic
1151326552 17:73383379-73383401 TCCTGGCCCCCTCTTTTTCCTGG - Intronic
1152813525 17:82393572-82393594 TGCAGGACACGTCCTTTTCCAGG + Intronic
1156608172 18:38693587-38693609 TGTATGCACCCTCCTTCTCAGGG - Intergenic
1158599787 18:58847356-58847378 TGTAGGCCCCTGCCTTTTGCGGG - Intergenic
1158607666 18:58910403-58910425 TGGACGCCCCCTCCCATTCCTGG + Intronic
1161280679 19:3443957-3443979 TGTAGGGCCCCTCCTGACCCCGG + Intronic
1162608754 19:11732834-11732856 TCTAGCCTCCCTCCCTTTCCTGG + Intronic
1163547179 19:17947548-17947570 TGAAGCCCCACTCCTTTGCCTGG - Intergenic
1165147402 19:33739987-33740009 TGGAGGCCCTTTCATTTTCCTGG + Intronic
925411822 2:3643923-3643945 CGAAGGCGCCCTCCTTCTCCAGG - Exonic
925455320 2:4011439-4011461 TGTTGGCCCCTTCCATATCCTGG + Intergenic
926247138 2:11130003-11130025 TGTAGGCCCCCGCCCCTTCCCGG - Intergenic
927169918 2:20360704-20360726 TGTAAGCCTCCTTCTCTTCCAGG + Intergenic
927869289 2:26613517-26613539 TGCAATCCCCCTCCCTTTCCTGG + Intronic
927952037 2:27177564-27177586 TGTAGCCTCCCTCCTGTACCTGG + Intergenic
930673985 2:54180328-54180350 TTTAGCCCCCCTCCTTTCCCTGG + Intronic
933348939 2:81128013-81128035 TGTAGGCTCCCTTCTGCTCCAGG + Intergenic
943432881 2:187826231-187826253 GGTATGCCCCCTCCGATTCCAGG - Intergenic
943852587 2:192744500-192744522 TATAGGCCACCTACTTTTCTTGG - Intergenic
946163909 2:217852314-217852336 TGCAGGCCCCCTCCTGAGCCAGG + Intronic
1168850246 20:971854-971876 TGTAGGCCTCCTCCTGCCCCAGG - Intronic
1169217237 20:3800898-3800920 AGCATGCCCCCTCCTCTTCCCGG - Intronic
1171422099 20:25024351-25024373 TGGAGGACACCTCCTTTTCCTGG - Intronic
1173838112 20:46138903-46138925 TGGAGGCCCCCTGCTGTGCCAGG + Intergenic
1175544718 20:59770940-59770962 TCTCAGCCCCCACCTTTTCCTGG + Intronic
1175699220 20:61125097-61125119 TGTATGAACCCTCCTTCTCCTGG - Intergenic
1179390084 21:40980447-40980469 TGTAGGCCCCCTCCCTCTGTGGG - Intergenic
1180904236 22:19397266-19397288 AGTAGGCCTCCTCCTTATCAGGG - Intronic
1181649838 22:24252697-24252719 GGAAGGCCGCCTCCTTCTCCCGG - Intergenic
1181707340 22:24657120-24657142 GGAAGGCCGCCTCCTTCTCCCGG + Intergenic
1182471477 22:30551120-30551142 TGTAGACCCCATACTTTTTCAGG + Intergenic
1183020570 22:35023021-35023043 TCTAGGGCCCCGCCGTTTCCTGG - Intergenic
1183420703 22:37709794-37709816 TCTAGCCCCCGCCCTTTTCCTGG + Intronic
1183801400 22:40167950-40167972 TGCAGGCCCCCTCACTTTCATGG - Intronic
1184602764 22:45553190-45553212 TCTAGGCCCCCTCCTTCTCCTGG - Intronic
1185042170 22:48510670-48510692 TGAAGGCCTCCTCCTCCTCCAGG + Intronic
949211533 3:1508835-1508857 TGTATGCACTCTTCTTTTCCAGG + Intergenic
949506703 3:4735228-4735250 TGGAAGCCCCCTCCTTGTCAAGG - Exonic
950610419 3:14123555-14123577 GGTAGGCCACCTCCTTCTCTGGG + Intronic
953013514 3:39051522-39051544 TGGAGGCCACCTCCTTTGCAAGG + Intergenic
953996142 3:47521515-47521537 TGTAGCCCCACTTCTCTTCCAGG + Intergenic
958264910 3:91426776-91426798 TTTCAGCCCCCTCCTTTTCCTGG - Intergenic
961559305 3:127717740-127717762 TGCAGGGCCCCTCCTTTCTCTGG - Intronic
965635930 3:170780582-170780604 TGGAGGCCCTCTCATTTTACTGG + Intronic
968651189 4:1760916-1760938 TGCAGGCCCCCTTCTCTTCCTGG + Intergenic
970385359 4:15550496-15550518 AATGGGCCTCCTCCTTTTCCAGG - Intronic
973710942 4:53629763-53629785 TGTTGGCCTCCACATTTTCCAGG - Intronic
976653058 4:87456558-87456580 TGTAGGCCCCCTCTTCATACTGG + Intronic
978690866 4:111507615-111507637 TGAAGGCCCCCTCCTACTTCTGG - Intergenic
987411002 5:17615015-17615037 TGTAGGCCGCGCCCTTTTGCTGG + Intergenic
987746081 5:21973796-21973818 TGTAGCCTCCCTCATTTTCTGGG + Intronic
987889938 5:23864022-23864044 AGCCGGGCCCCTCCTTTTCCTGG + Intergenic
988269260 5:28992843-28992865 TGTAGGCCCCCACTTTCTTCTGG - Intergenic
994049048 5:95342207-95342229 TGTTGGCCTCATCCTTTTTCTGG + Intergenic
998484747 5:142491848-142491870 TGTCGGCCTCCAGCTTTTCCTGG + Intergenic
1001644456 5:173269777-173269799 TGCAGGCTCACTCCCTTTCCTGG + Intergenic
1002660872 5:180790503-180790525 TGCCTGCCACCTCCTTTTCCAGG + Intergenic
1003157019 6:3605377-3605399 TGTAGGGCCTCTGCTTTCCCAGG - Intergenic
1003688975 6:8333350-8333372 TTTAGGCCAACACCTTTTCCAGG - Intergenic
1005313937 6:24586449-24586471 TGTAGTCACCCTTCTCTTCCTGG - Intronic
1008154325 6:47995227-47995249 TGTTGGCCACCTCCTTTTGTTGG - Intronic
1008990473 6:57595884-57595906 TTTCAGCCCCCTCCTTTTCCTGG + Intronic
1009019938 6:57938464-57938486 GGAATGCCCCCTCTTTTTCCAGG - Intergenic
1009179047 6:60494430-60494452 TTTCAGCCCCCTCCTTTTCCTGG + Intergenic
1010733720 6:79417926-79417948 TATAAGACCCCTCCTTTTCATGG - Intergenic
1011779483 6:90770973-90770995 TGCAGCCCCTCTCCTTTCCCTGG + Intergenic
1019872218 7:3775067-3775089 TGTTGTCCCACTCCTGTTCCTGG + Intronic
1025093564 7:56081560-56081582 TCTAAGCCCCCTCCTCTCCCAGG - Intronic
1026923547 7:74173864-74173886 TAAAGGCCACCTCCTTCTCCAGG - Intergenic
1029171501 7:98632421-98632443 TGTAAGCCCACTACTCTTCCTGG + Intergenic
1029306587 7:99624262-99624284 TGAAGTCCCCTTCCTTTGCCAGG - Intronic
1031119064 7:117699919-117699941 TTTGGGCCCACTCTTTTTCCAGG - Intronic
1032205815 7:129864237-129864259 TGTCTCCCCCCTCCTTGTCCAGG - Intronic
1032362704 7:131271174-131271196 TGTAGGCCCCCTCCTTTTCCTGG - Intronic
1032814688 7:135461040-135461062 TGCAGGCCCCATCCTATTCATGG - Intronic
1034496894 7:151428500-151428522 TGTTGGCCCCTTCCCCTTCCTGG - Intergenic
1035446302 7:158945285-158945307 TGATGGCCCCCACCTTCTCCAGG + Intronic
1035474949 7:159136706-159136728 TCGGGGCCTCCTCCTTTTCCTGG - Intronic
1036435235 8:8726767-8726789 TTCATGCCCCCTCCTCTTCCTGG - Intergenic
1036560354 8:9896555-9896577 TGTTAGCCCCCTCCTTTCCTAGG + Intergenic
1038405581 8:27320099-27320121 AGTCTGGCCCCTCCTTTTCCTGG + Intronic
1038729373 8:30113501-30113523 AGTAAGCCCCCTCCTGCTCCTGG - Intronic
1040671149 8:49691842-49691864 TGTAGGCTCCCTCCATCCCCAGG - Intergenic
1042591863 8:70403998-70404020 TTTCCGCCCCGTCCTTTTCCCGG - Intergenic
1045843470 8:106606191-106606213 TAGAGGCCCCCTACTTTCCCTGG + Intronic
1046775337 8:118158468-118158490 GGTAGGACCCCTGCTTTTCCAGG + Intergenic
1054849818 9:69836193-69836215 TGTTGGCCCCATCCTTTTTGGGG + Intronic
1055640443 9:78315209-78315231 TGCAGGCCCTCTGCTTTGCCAGG - Intronic
1059335933 9:113568516-113568538 TGCAGGCCGTCTCCTCTTCCTGG + Intronic
1061669500 9:132180615-132180637 TGCAGACCCCCTCATTTTACAGG - Intronic
1185621986 X:1455613-1455635 TTTAGGGCCCGTCCTTCTCCAGG + Intergenic
1186774758 X:12854099-12854121 TGGAGGCCTGCTCCTTCTCCTGG + Intergenic
1186812408 X:13203501-13203523 TGTTGTCCCCTTGCTTTTCCTGG + Intergenic
1192194508 X:69019274-69019296 TGCAGGCCCCTTCCTTCTACTGG - Intergenic
1194055668 X:89128282-89128304 TGGTGGCCCACTCCTTTACCTGG + Intergenic
1194067905 X:89284621-89284643 TGTAGGATCCCTCCTGTTTCTGG + Intergenic
1194660034 X:96620812-96620834 TGTCTGCCTCCTCCTTCTCCAGG - Intergenic
1196968838 X:121086931-121086953 TGTAGGTCCACCCATTTTCCTGG + Intergenic
1198747511 X:139905223-139905245 TGTAAGCCCCGTCTTTTCCCAGG - Intronic