ID: 1032364382

View in Genome Browser
Species Human (GRCh38)
Location 7:131285481-131285503
Sequence CTTATTATCAGATGGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032364378_1032364382 23 Left 1032364378 7:131285435-131285457 CCGAAATGAGGTAGAAGCTCAGC 0: 1
1: 0
2: 4
3: 9
4: 127
Right 1032364382 7:131285481-131285503 CTTATTATCAGATGGATGTGAGG 0: 1
1: 0
2: 0
3: 12
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032364382 Original CRISPR CTTATTATCAGATGGATGTG AGG Intronic
901621379 1:10590791-10590813 GTTAATATCAGATTAATGTGAGG + Intronic
904957663 1:34298665-34298687 CTTAATAATAGATGGATGTGGGG - Intergenic
905758509 1:40533220-40533242 CTTTTTATCATATGGATTTTTGG - Intronic
905900656 1:41580268-41580290 CTTTGTGTCAGATGGATCTGAGG + Exonic
906777318 1:48541429-48541451 CTTATTGTCAGATGAGTGTGTGG - Intronic
909333249 1:74440736-74440758 CTTATTATAGTGTGGATGTGTGG + Intronic
910102672 1:83595413-83595435 CTAATTAGCATATGCATGTGAGG - Intergenic
911855581 1:102871543-102871565 CTTATTCTCAGATGGAACTTTGG - Intergenic
915058512 1:153159366-153159388 GTTGTTCTCAGATGGAGGTGAGG - Intergenic
915577196 1:156787164-156787186 CTTATTATCAGGTGGGTAGGAGG + Exonic
921868940 1:220116604-220116626 ATTATTATAAGTTGGATCTGAGG + Intronic
922955200 1:229593858-229593880 CTTGTTGGCAGAGGGATGTGGGG - Exonic
923857522 1:237861026-237861048 CGCATTATCACATGGTTGTGTGG - Intergenic
1063413988 10:5858283-5858305 TTTAATATTAGATGGAGGTGGGG - Intergenic
1066009012 10:31176224-31176246 CTGATCAGCACATGGATGTGAGG - Intergenic
1067244088 10:44521833-44521855 CTTATTATTACATTGATTTGTGG + Intergenic
1068529198 10:58165630-58165652 CCTATTTTCAGATGGATATGAGG + Intergenic
1068920866 10:62482551-62482573 CTGATTCTTAGATGGGTGTGTGG + Intronic
1069361387 10:67646581-67646603 TTTTTTGTGAGATGGATGTGGGG - Intronic
1076253123 10:128998570-128998592 CATATTATCAGCTGGTTTTGAGG - Intergenic
1077847603 11:6042528-6042550 CTGATTAGCATATGCATGTGAGG - Intergenic
1078914563 11:15767006-15767028 ATTATAATTAGAAGGATGTGGGG + Intergenic
1080554477 11:33403633-33403655 CTTTTTATCAGTTGTAGGTGTGG - Intergenic
1082635347 11:55586834-55586856 CTTATTAGCAGAAGAAGGTGGGG + Intergenic
1086942318 11:92811252-92811274 CTTATTAGCAGATGACTTTGGGG + Intronic
1087255268 11:95946088-95946110 CTGATTATCAAAGGGATATGGGG - Intergenic
1088044021 11:105425442-105425464 TTTATTATAGGATGGGTGTGAGG + Intergenic
1088872414 11:113902232-113902254 CTTATTCTCAAATGATTGTGGGG - Intergenic
1089186188 11:116616240-116616262 CTTATTATCAGAGGTAAGGGAGG + Intergenic
1089737853 11:120562412-120562434 CTTAGTCTCAGATGGATGGCAGG + Intronic
1090539627 11:127686964-127686986 CTCTTTATCAGATCCATGTGTGG + Intergenic
1093971250 12:25378034-25378056 CTTATTGACAATTGGATGTGGGG - Intergenic
1094192130 12:27708735-27708757 TTTTTAATCAGATGGAGGTGAGG - Intergenic
1095617480 12:44208638-44208660 CATATTATCAGATCAATGTCAGG - Intronic
1098562796 12:71895936-71895958 CTTATTTTTAGATTGATTTGGGG + Exonic
1099150134 12:79100594-79100616 CTTATTATCAGATGATGGGGTGG + Intronic
1099624941 12:85059666-85059688 CTGATTATAGGATGGATGAGTGG + Intronic
1099755054 12:86835182-86835204 CTTAATATGAGATGCATCTGAGG + Intronic
1102859116 12:116320176-116320198 CCAATCATCAGATGGAAGTGAGG + Intergenic
1103834915 12:123810925-123810947 CTTACTAATAGATGGATTTGAGG + Intronic
1105200749 13:18173084-18173106 ATTATTATCACATGAGTGTGGGG + Intergenic
1105693840 13:22869270-22869292 TTTATTATGAGATGGATGAATGG + Intergenic
1107872892 13:44763475-44763497 TTGATTATCAGAGGGATATGTGG - Intergenic
1108594023 13:51935105-51935127 GTTATTAAAAGATGGATGAGAGG - Intronic
1109195813 13:59376714-59376736 CTTATGCTAATATGGATGTGGGG + Intergenic
1110900709 13:80820015-80820037 CTTATTATCAAAGGAATGTCAGG + Intergenic
1111083415 13:83342361-83342383 GATATTCTCAGATGGAGGTGAGG + Intergenic
1112301448 13:98234234-98234256 CTTGTTCTTAGATGGATGGGAGG + Intronic
1113154353 13:107301296-107301318 CTTAATATCAGATTGCTGAGTGG - Intronic
1115264677 14:31488620-31488642 TTTATTAGCAGATGGATGGATGG + Intergenic
1115370446 14:32608066-32608088 CATATTATAAGATGTATGGGTGG + Intronic
1120288599 14:82537621-82537643 CTTATTATCACCTGGAAGGGAGG - Intergenic
1126261561 15:46699008-46699030 CTTATGAACAGATGAATGTGTGG - Intergenic
1136866769 16:33765565-33765587 CTTATGATCAGATGGCTGTCAGG - Intergenic
1137376601 16:47956964-47956986 CACATTGTCACATGGATGTGAGG - Intergenic
1137876260 16:51999406-51999428 TTTGTTATCAGATGAAGGTGGGG - Intergenic
1140245397 16:73243965-73243987 CTTGGTCTCAGTTGGATGTGAGG + Intergenic
1141253469 16:82379978-82380000 CTTCTTGTCAGATGGAGGGGAGG - Intergenic
1141378838 16:83557140-83557162 CTTATTGTCAACTGCATGTGAGG + Intronic
1203105393 16_KI270728v1_random:1350637-1350659 CTTATGATCAGATGGCTGTCAGG + Intergenic
1203128121 16_KI270728v1_random:1611731-1611753 CTTATGATCAGATGGCTGTCAGG - Intergenic
1153613679 18:6913191-6913213 CTTAAAATCAGATGCATGTCTGG + Exonic
1154145580 18:11863622-11863644 CTTAAAATCACATGGATTTGGGG + Intronic
1154280777 18:13001010-13001032 TTTATTACCAGATTGATGTTTGG + Intronic
1164935348 19:32206082-32206104 CTTGTTGTCAGATGGCTGTGAGG - Intergenic
1165667123 19:37641714-37641736 AATTTTATCAGATGGAAGTGTGG - Intronic
1165841948 19:38793373-38793395 CTTATTCTCAAATGGTTCTGAGG + Intergenic
925785497 2:7428669-7428691 CATATCATCAGATGGGTGAGGGG - Intergenic
927890146 2:26743038-26743060 CTTATTAGCAAATGGAGGGGAGG - Intergenic
931842153 2:66164724-66164746 CTCACTGTTAGATGGATGTGGGG + Intergenic
934116734 2:88805778-88805800 ATTATTATCACATGAGTGTGGGG - Intergenic
934807699 2:97250543-97250565 ATTATTATCACATGAGTGTGGGG - Intronic
935543268 2:104374564-104374586 CTTGTGAGCAAATGGATGTGTGG - Intergenic
935719723 2:105969329-105969351 CTTATTAGCAGAAGAAGGTGGGG - Intergenic
938626882 2:133119787-133119809 CTTATGATCACATGGCTATGTGG - Intronic
938639089 2:133261569-133261591 CTTATTCTCAGCTGGAAGAGGGG - Intronic
939407337 2:141775371-141775393 CTTATTTTCATATATATGTGTGG + Intronic
939559892 2:143719952-143719974 CTTATTATAGGGTGTATGTGTGG - Intronic
944136322 2:196403985-196404007 GTTTTTCTCAGATGAATGTGAGG - Intronic
946573525 2:221050190-221050212 CTTAGTAACAGATGTTTGTGTGG + Intergenic
946796404 2:223358918-223358940 CTTATTAAGAAATAGATGTGAGG - Intergenic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169738424 20:8863275-8863297 ATTATTGTCAGATGCAGGTGTGG - Intronic
1170002254 20:11627674-11627696 CTTATTATCTGAAGGATGGGAGG + Intergenic
1170804761 20:19619831-19619853 CTGATTATGAGATGGCCGTGCGG + Intronic
1171119312 20:22554727-22554749 GTGATGTTCAGATGGATGTGTGG + Intergenic
1179276347 21:39895243-39895265 ATAAATAGCAGATGGATGTGTGG - Intronic
949739409 3:7213339-7213361 CTTATTATGAGATAAATGAGTGG - Intronic
953073295 3:39545099-39545121 CTGAATATCAGATAGATTTGGGG - Intergenic
957869149 3:86065297-86065319 CATATTTTCAGATGGAGGTGAGG + Intronic
963219653 3:142794694-142794716 CTGATTAGCATATGCATGTGAGG + Intronic
964736844 3:159926719-159926741 CATCTTAACAGATGGATTTGTGG - Intergenic
964845066 3:161036455-161036477 ATTATTAGTAGATTGATGTGAGG + Intronic
965930397 3:174035758-174035780 CTTATTATGAAATGGAATTGCGG - Intronic
967487426 3:190049472-190049494 CTTATTCTCAGGTTGATGAGTGG + Intronic
967613487 3:191536606-191536628 ATTATTACCAGCTGGATATGGGG + Intergenic
967799786 3:193643964-193643986 ATTTTTTTCAGATGGATCTGTGG + Exonic
968733547 4:2283510-2283532 CTGATGATTAGATGGATGGGTGG - Intronic
969033726 4:4233651-4233673 CTTATTATGAGAGGGTTTTGAGG - Intergenic
971631390 4:28997952-28997974 CTCATTCTCAGATGGAGATGAGG + Intergenic
975231486 4:71939418-71939440 ATTATTATCATATGTGTGTGGGG - Intergenic
975391286 4:73820775-73820797 CTGATTATCAGTGGGATGTCAGG - Intergenic
978482680 4:109212184-109212206 ATTATTATCCTATGGTTGTGTGG + Intronic
980004436 4:127525376-127525398 CTTATTATTAAAGAGATGTGTGG + Intergenic
981002441 4:139840660-139840682 CTTATGAACAGGTGGAGGTGGGG + Intronic
982174803 4:152695490-152695512 TTTATTATTAGATGGATTTTCGG + Intronic
982796543 4:159653110-159653132 CTTTTTCACACATGGATGTGAGG - Intergenic
982979047 4:162107098-162107120 GTTACTATCACATGAATGTGGGG + Intronic
986002261 5:3639557-3639579 CTTCTTATTAGATGGGTGGGAGG + Intergenic
987451105 5:18085035-18085057 CTGATTACCAGATGGAGGTCTGG - Intergenic
987603991 5:20108924-20108946 CTTATTATTACATACATGTGAGG - Intronic
988001199 5:25351414-25351436 CATAATATCAAATGGAAGTGTGG + Intergenic
988090843 5:26538960-26538982 CTGATCATCATAAGGATGTGTGG + Intergenic
990622441 5:57575428-57575450 CATCTCATCAGATGGTTGTGAGG + Intergenic
991663172 5:68970488-68970510 CTAATTATCTGCTGGATGTTTGG + Intergenic
992150301 5:73895974-73895996 CTGATAAACAGATGGATGAGGGG - Intronic
995076444 5:107990283-107990305 CTAATTATAAGATTGATGTTTGG + Intronic
998969761 5:147578483-147578505 ATTACTTTCATATGGATGTGGGG + Intergenic
999847346 5:155498946-155498968 CTTATTATCAGATGACAATGAGG + Intergenic
1000513015 5:162207095-162207117 CATATGAGCAGATGCATGTGAGG + Intergenic
1000649786 5:163803105-163803127 CTGATCATCACATGCATGTGAGG - Intergenic
1001679869 5:173548561-173548583 CTTATTGTTAGAAGGATGTCTGG - Intergenic
1003237363 6:4307938-4307960 CTGATTTTCAGATTGATTTGGGG - Intergenic
1008129711 6:47706753-47706775 CTTTTTATCAGAGTGATGTTGGG + Intronic
1009879377 6:69546326-69546348 CTTAGTATCAAAAGAATGTGTGG - Intergenic
1015210030 6:130686549-130686571 ATTATTATCAAATGGTTCTGTGG + Intergenic
1015532919 6:134239256-134239278 TGTATTATCAGAGGGAAGTGGGG - Intronic
1016131192 6:140473999-140474021 ATAATTCTCAGATGGAGGTGGGG + Intergenic
1016292817 6:142542343-142542365 CTTATTAGCAGAAGAAGGTGGGG + Intergenic
1018201368 6:161398767-161398789 CTGATCATATGATGGATGTGAGG + Intronic
1019345525 7:528179-528201 CTTATTTTCAAATGGTTGGGAGG + Intergenic
1023495969 7:40797512-40797534 CTGTTGACCAGATGGATGTGGGG - Intronic
1024711759 7:52023099-52023121 CTTATTTTCTGATAGAAGTGTGG - Intergenic
1030264868 7:107609521-107609543 TTTATCAACAGATGGGTGTGAGG + Intronic
1032364382 7:131285481-131285503 CTTATTATCAGATGGATGTGAGG + Intronic
1034319343 7:150165172-150165194 CTTGAGATCAGATGGTTGTGTGG - Intergenic
1035551101 8:526541-526563 CTTTTTATCCCAGGGATGTGAGG - Intronic
1038041013 8:23724236-23724258 ATTATTTTCAAATGGAGGTGAGG + Intergenic
1038624192 8:29174600-29174622 CTTACTATCTGATGTTTGTGAGG + Intronic
1039765976 8:40628521-40628543 CTTATAATAAAATGGATGGGAGG - Intronic
1041916569 8:63145058-63145080 CTTATTAGCAGAAGAAGGTGGGG - Intergenic
1043264215 8:78242681-78242703 CTTATTAGCAGATGGGTGAAAGG - Intergenic
1043335276 8:79168561-79168583 CTTCTTATGAAATGTATGTGAGG - Intergenic
1043580388 8:81705567-81705589 TTTATTATAAGATGGATATAAGG + Intronic
1043790167 8:84455971-84455993 CTACTTATCAGATAGATTTGAGG - Intronic
1043856891 8:85274591-85274613 CTTATTAGCAGAAGAAGGTGGGG - Intronic
1046947728 8:119989757-119989779 CTCATTATCAGATGCCTGAGTGG + Intronic
1047091647 8:121582060-121582082 TGTATTATCTGATGGATCTGGGG + Intergenic
1048211956 8:132461921-132461943 CTCTTTATCAGATAGGTGTGTGG + Intronic
1050957637 9:11685639-11685661 CTTATTACCAAAAGGAAGTGGGG + Intergenic
1051427457 9:16947487-16947509 TAAATGATCAGATGGATGTGTGG - Intergenic
1051926851 9:22338455-22338477 CTTATTTTCAGATGTCTGTGAGG - Intergenic
1052276754 9:26685423-26685445 CTTATAAACAGATGGAAGTTTGG + Intergenic
1052956440 9:34256241-34256263 CTTATTATCAGGGGGAGATGAGG + Exonic
1055064147 9:72101678-72101700 TTTATTATCAGAGGGACTTGGGG + Intergenic
1056204189 9:84304668-84304690 GTTATTGTCAGGTGGATTTGAGG - Intronic
1057245167 9:93449385-93449407 CTTATCATAAGATGGATATTGGG + Intronic
1058035957 9:100253242-100253264 ATGATTAACAGATGGATTTGTGG - Intronic
1058659264 9:107254519-107254541 TTTATTATCAGAAGGTTGTCTGG - Intergenic
1058881219 9:109287618-109287640 CACATCATCTGATGGATGTGGGG - Intronic
1059156866 9:111997776-111997798 CTTCTCAACAGATGGATTTGAGG + Intergenic
1203583605 Un_KI270746v1:40855-40877 ATTATTATCACATGAGTGTGGGG - Intergenic
1195420294 X:104667899-104667921 ATTATTTTCAGCTGGGTGTGAGG + Intronic
1196277707 X:113787219-113787241 CTTATTACCATATAAATGTGAGG - Intergenic
1197162999 X:123344870-123344892 TTTATTATCAGATGGAAAGGTGG + Intronic
1198113060 X:133519852-133519874 TTTATTATCACATGGATCTGTGG + Intergenic
1198794988 X:140385152-140385174 CTTCTAATAAAATGGATGTGGGG - Intergenic
1200918114 Y:8589340-8589362 CTTTTTTGCAGATGAATGTGTGG - Intergenic