ID: 1032369849

View in Genome Browser
Species Human (GRCh38)
Location 7:131337662-131337684
Sequence GATGATGGAAATAGGCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1032369849_1032369853 7 Left 1032369849 7:131337662-131337684 CCTATAGGCCTATTTCCATCATC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1032369853 7:131337692-131337714 TTTTGATTTTGCATCTTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1032369849 Original CRISPR GATGATGGAAATAGGCCTAT AGG (reversed) Intronic
904959232 1:34318123-34318145 GATGAAGGAAACAGGCTTCTTGG - Intergenic
906884564 1:49630408-49630430 GCTGAGGAAAATAGGCCTGTTGG - Intronic
909217932 1:72915545-72915567 GAGGAGGGAAATAGGACTAAAGG - Intergenic
910592552 1:88942390-88942412 GTTAATAGAAATAGGCCTAAAGG - Intronic
911065163 1:93781578-93781600 GATGATGAAAACAGGGCTCTGGG + Intronic
911379774 1:97098492-97098514 GATGGTAGGAATAGGCCTTTTGG + Exonic
911422245 1:97657976-97657998 GATAGTTGAAATAGACCTATAGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
1063891437 10:10633121-10633143 GATTATGGAAATGGGCTTTTGGG + Intergenic
1064146459 10:12829949-12829971 GCTGATGGCAAGAGGCCTCTAGG - Exonic
1065251266 10:23816824-23816846 AATGGTGGAAATCGGCCTTTGGG + Intronic
1066400526 10:35071970-35071992 CATGATGGAAGTTGGCCTTTTGG - Intronic
1070609033 10:77920830-77920852 GATGGTGGAAACTGGCCTTTGGG - Intronic
1071188624 10:83075007-83075029 GATGGTGGAAACAAGCCTCTAGG + Intergenic
1073275388 10:102305926-102305948 AATGATGGAAATAGGATGATAGG + Intronic
1075242162 10:120788927-120788949 GATGATGGGAATGAGCCCATGGG + Intergenic
1077441375 11:2570731-2570753 GATGATGGAAATGGGCTTCCGGG - Exonic
1077677566 11:4209868-4209890 GATGGTGGAATTATGGCTATGGG + Intergenic
1077704346 11:4469926-4469948 GATGATGGAAATAGACACCTTGG + Intergenic
1080495285 11:32811819-32811841 GATGCTGGAGGTAGGCCTAGTGG - Intergenic
1080762234 11:35262810-35262832 GATGATGAAAATAGCTCTATTGG - Intronic
1080933034 11:36833372-36833394 CATCATGGATATAGGCCTAAAGG + Intergenic
1083263792 11:61536929-61536951 CATGAGGGAAACAGGCCTTTGGG - Intronic
1087036003 11:93757391-93757413 CATTATGGAAATAAGCCTATAGG + Exonic
1088058309 11:105611302-105611324 AAAGGTGGAAATAGGGCTATGGG - Intronic
1089535619 11:119159183-119159205 AATGATGAAAATAACCCTATAGG + Intronic
1093611908 12:21171191-21171213 AATGATAGAAATACGACTATGGG + Intronic
1097677051 12:62614190-62614212 GAGGCTGGAAATAGGGTTATGGG + Intergenic
1101237221 12:102802006-102802028 GATGTTGGAAATACTCGTATTGG + Intergenic
1101509528 12:105380181-105380203 GATGATGGAAATAATCCTGTAGG - Intronic
1101528490 12:105553515-105553537 GATGAAGAAAGTAGGCTTATGGG + Intergenic
1101646982 12:106640551-106640573 AATGATGGAAAGAGGCCAAAAGG - Intronic
1102124350 12:110468428-110468450 GTTGATGGAAATCGGCCGTTGGG + Exonic
1103249963 12:119491138-119491160 CATCATGGAAAGATGCCTATTGG - Intronic
1104099316 12:125591404-125591426 GATGATGGAATTAGCCATGTGGG - Intronic
1108575868 13:51790135-51790157 GGGGATGGAAATAGGTCTTTTGG - Intronic
1108691661 13:52864527-52864549 GAAGATGGGATTTGGCCTATGGG + Intergenic
1114639765 14:24211655-24211677 AATGAGGGAAACAAGCCTATGGG - Intronic
1120669317 14:87346016-87346038 GTTGATGAGAATAGGACTATGGG + Intergenic
1129192850 15:73947507-73947529 GCTGATGGAAAGAGGGATATGGG - Intronic
1137010558 16:35316217-35316239 GATGTTGGAAATTGTCCTATAGG + Intergenic
1138471554 16:57242338-57242360 GATGGTTGAAATAGGCCCTTTGG + Intergenic
1140963925 16:79945288-79945310 GATGATGGCAATAAGCCTGGAGG + Intergenic
1141113094 16:81286403-81286425 CCAGAGGGAAATAGGCCTATTGG + Intronic
1141214669 16:82011849-82011871 GATGATGGAAAAGGCTCTATAGG + Intergenic
1145234815 17:21200983-21201005 GATGGTGGAAATCGGACTGTCGG + Intronic
1146099292 17:29963790-29963812 GATGTTGGAAGTGGGCCTAGTGG + Intronic
1149158697 17:53665405-53665427 GAGGGTGGAAATAGCCATATTGG + Intergenic
1157987270 18:52452426-52452448 GATAATGGAAATGTGCTTATGGG - Intronic
1159398067 18:67890687-67890709 GATGATTGAAATTAGGCTATAGG + Intergenic
1159445623 18:68538572-68538594 GATGATGAAAATAGGTTAATGGG - Intergenic
1159445822 18:68540750-68540772 GATGATGAAAATAGGTTAATGGG - Intergenic
1164737453 19:30552369-30552391 GATTATAGAAACAGGCTTATAGG + Intronic
1165144075 19:33720551-33720573 GATGGTGGACAGAGGCCAATGGG - Intronic
930453149 2:51570032-51570054 AATGTTGGAAATAGGGCTAATGG + Intergenic
931506982 2:62939592-62939614 GATGGTGAGAATAGGCCTAATGG + Intronic
935009111 2:99114435-99114457 CAAAATGGAAATAGGCCTTTGGG - Intronic
935114898 2:100127094-100127116 GATGATGGAATGATGCCTCTTGG - Intronic
937084998 2:119165744-119165766 GAAAATGGAAACAGGCCTGTGGG - Intergenic
942955677 2:181770272-181770294 GTTGATGGCAAGAGGCCTTTAGG + Intergenic
1172191952 20:33067436-33067458 GAGGTTGGAAAGAGGCCTAGGGG + Intronic
1174157604 20:48526544-48526566 GATGATGGAAATTGGTCAAAAGG + Intergenic
1174277928 20:49417162-49417184 GATGCTGGCAAAAGGCCTAGGGG + Intronic
1174366348 20:50058889-50058911 GTGGAGGGAAATAGGCCTTTGGG + Intergenic
1174969963 20:55264075-55264097 GATGATGGAATTAAGCCTTCAGG + Intergenic
1175677237 20:60957340-60957362 GATGAGGGAGATGGGCCTAAGGG - Intergenic
1184675275 22:46038367-46038389 GATCATGGAAATAGCCCCATTGG + Intergenic
950024594 3:9811418-9811440 GCTGATGGAATTAGACCTGTGGG - Intronic
954628331 3:52034981-52035003 GATGATGGACATGATCCTATGGG + Intergenic
959857118 3:111172721-111172743 GATCAAGGAAACAGGCCAATAGG - Intronic
960264173 3:115601807-115601829 GAGGATGGAAAAAGGCATGTAGG - Intergenic
962039133 3:131686381-131686403 GATAATAAAAATAGACCTATAGG - Intronic
962231595 3:133670231-133670253 GAGGATGGCAATAGCCTTATGGG + Intergenic
965712795 3:171572882-171572904 GATGATGGAATTAGATATATGGG - Intergenic
971034585 4:22679076-22679098 GTTGTTGGAAACACGCCTATTGG + Intergenic
972396252 4:38662248-38662270 GAAGAGCGAAATAGGCCTGTCGG - Intergenic
974696641 4:65384175-65384197 TATGATGGAAAAAGGCGCATGGG - Intronic
974976716 4:68902322-68902344 GATGATGGAAATTCTCCAATGGG - Intergenic
976480627 4:85540318-85540340 GATGTTTAAAATAGGCCTCTGGG - Intronic
977367899 4:96095210-96095232 GATGATGGAAGTAGGTATACAGG + Intergenic
980211256 4:129791220-129791242 GATGAAGAAAAGAGGGCTATGGG + Intergenic
980240292 4:130164620-130164642 GATGATGGAAATATGGCTGTTGG + Intergenic
980250560 4:130309511-130309533 GATTAAGGAACTACGCCTATGGG + Intergenic
984035552 4:174663588-174663610 GATGAGGAAAGTAGGCCTTTAGG - Intronic
984475137 4:180225747-180225769 GATTGTGGAAATAGTCATATGGG + Intergenic
993469600 5:88290990-88291012 GAGGATGGAACTAGACCCATTGG + Intergenic
996842620 5:127864400-127864422 GTTGATGGAAACAGGCTTAGAGG + Intergenic
998684896 5:144513257-144513279 GCTTATAGAAACAGGCCTATTGG - Intergenic
999764256 5:154726442-154726464 GATAATAGCAATAGGCCCATAGG + Intronic
1000941216 5:167362582-167362604 CATGATGGAAATAGGCACCTTGG + Intronic
1003542615 6:7031834-7031856 GATAATGGAAAGAGGCCGATTGG - Intergenic
1010650398 6:78447970-78447992 GAAGATGGAAATAGATCTGTGGG - Intergenic
1011236559 6:85224724-85224746 GATCATTTAAATAAGCCTATAGG + Intergenic
1014134234 6:117869256-117869278 GATGAGGAAAATGGCCCTATAGG - Intergenic
1014279751 6:119428580-119428602 GGGGATTGAGATAGGCCTATGGG + Intergenic
1015723365 6:136270366-136270388 GAAGATGGAAAGAGGCATCTAGG + Intronic
1016109412 6:140203905-140203927 GATGATGGAAACATTCCTATTGG - Intergenic
1026112332 7:67468392-67468414 GAACATGGACAAAGGCCTATTGG - Intergenic
1031756676 7:125652390-125652412 GATGGTGGAGAAAAGCCTATAGG + Intergenic
1032369849 7:131337662-131337684 GATGATGGAAATAGGCCTATAGG - Intronic
1032524928 7:132572867-132572889 GATTAGGGTAATTGGCCTATAGG - Intronic
1036926543 8:12912200-12912222 GCTGATGGAAAAAGGCATTTTGG - Intergenic
1037202601 8:16276130-16276152 GATGAAGGAACTGGGCATATAGG + Intronic
1037630426 8:20650766-20650788 GATGATTGAATTGGGCCTCTTGG + Intergenic
1041591270 8:59587429-59587451 GAAGTTGGAAATAAGCCTCTTGG - Intergenic
1043359037 8:79448986-79449008 GATGATAAAAATAGGAATATTGG + Intergenic
1044347264 8:91119977-91119999 GCTGATGGAAATAACCCTGTAGG - Intronic
1046101460 8:109618964-109618986 GATGCTGGAAACAGCCCCATTGG - Exonic
1046295725 8:112217366-112217388 GATTGTGGAAATAGACCAATAGG - Intergenic
1051136719 9:13931083-13931105 GCTAATGGAAATAGGACTAATGG - Intergenic
1051325106 9:15958294-15958316 GATGATAGAAATATGGCTTTGGG + Intronic
1053412445 9:37924486-37924508 AAGGATGGAAATTGGCCTTTGGG + Intronic
1055462884 9:76535969-76535991 GATGAGGGTAATATGTCTATAGG + Intergenic
1055559518 9:77508847-77508869 GATGCTGGAAATTGGCCAATAGG - Intronic
1057587701 9:96344602-96344624 GCTCATGGAAATAAGCCTGTTGG + Intronic
1188219024 X:27517284-27517306 GATGGTGGAATTATGGCTATGGG + Intergenic
1188373468 X:29397934-29397956 AATGTTGGAAATAGGACTAAAGG - Intronic
1194700489 X:97107907-97107929 GATGATAGAAATAACCCTAAAGG + Intronic
1195331654 X:103807865-103807887 AATGGTGGAAACAGGCCTCTGGG - Intergenic